[29340] in Perl-Users-Digest
Perl-Users Digest, Issue: 584 Volume: 11
daemon@ATHENA.MIT.EDU (Perl-Users Digest)
Tue Jun 26 16:09:44 2007
Date: Tue, 26 Jun 2007 13:09:11 -0700 (PDT)
From: Perl-Users Digest <Perl-Users-Request@ruby.OCE.ORST.EDU>
To: Perl-Users@ruby.OCE.ORST.EDU (Perl-Users Digest)
Perl-Users Digest Tue, 26 Jun 2007 Volume: 11 Number: 584
Today's topics:
Re: Assigning another filehandle to STDOUT, using binmo <rvtol+news@isolution.nl>
Re: Converting Diff Output to XML? <debajit1@gmail.com>
Re: Converting Diff Output to XML? <bik.mido@tiscalinet.it>
Re: executing bash comands with pipe <jurgenex@hotmail.com>
Re: FAQ 1.6 What is perl6? <bik.mido@tiscalinet.it>
Re: FAQ 1.6 What is perl6? <bik.mido@tiscalinet.it>
Re: FAQ 1.6 What is perl6? <bik.mido@tiscalinet.it>
Re: gcc help <mark.clementsREMOVETHIS@wanadoo.fr>
Re: How to replace the "\" in "C:\myrootr\folder" with <noreply@gunnar.cc>
Re: How to replace the "\" in "C:\myrootr\folder" with <noreply@gunnar.cc>
Re: How to replace the "\" in "C:\myrootr\folder" with <jurgenex@hotmail.com>
Re: Perl Best Practices - Code Formatting. <kkeller-usenet@wombat.san-francisco.ca.us>
Problem with PERL function <mzhao1@gmail.com>
Re: Problem with PERL function <mritty@gmail.com>
Re: Problem with PERL function usenet@DavidFilmer.com
Re: Problem with PERL function <dummy@example.com>
Re: sort function, in non-standard cases <joe@inwap.com>
Re: sort function, in non-standard cases <joe@inwap.com>
Re: strings with formatted characters in %ARGV mfrost8@gmail.com
Re: The Modernization of Emacs: terminology buffer and <k.s.matheussen@notam02.no>
Digest Administrivia (Last modified: 6 Apr 01) (Perl-Users-Digest Admin)
----------------------------------------------------------------------
Date: Tue, 26 Jun 2007 20:06:15 +0200
From: "Dr.Ruud" <rvtol+news@isolution.nl>
Subject: Re: Assigning another filehandle to STDOUT, using binmode.
Message-Id: <f5rrph.110.1@news.isolution.nl>
Adam Funk schreef:
> I think I get it. String literals and variables just contain strings
> of bytes, and encoding is a consideration only for input and output
> --- or is that only for output?
A Perl text string contains characters. See perlunitut:
http://search.cpan.org/perldoc?perlunitut
--
Affijn, Ruud
"Gewoon is een tijger."
------------------------------
Date: Tue, 26 Jun 2007 18:22:57 -0000
From: Debajit Adhikary <debajit1@gmail.com>
Subject: Re: Converting Diff Output to XML?
Message-Id: <1182882177.212634.308450@g4g2000hsf.googlegroups.com>
On Jun 26, 2:00 pm, Debajit Adhikary <debaj...@gmail.com> wrote:
> On Jun 26, 12:15 pm, Michele Dondi <bik.m...@tiscalinet.it> wrote:
> > On Tue, 26 Jun 2007 14:57:25 -0000, Debajit Adhikary
>
> > <debaj...@gmail.com> wrote:
> > >What would be the best way to convert the regular (unix) diff output
> > >into XML?
> > >Are there any diff "libraries" available?
>
> > Searching CPAN for diff returns tons of things most of which are
> > probably *not* what you're looking after since the term is
> > unfortunately so generic... But hopefully instead of parsing the
> > output of diff you may generate diff information yourself e.g. with
> >Text::Diffand then produce your XML from there, with the aid of and
> > XML dedicated module. It all really depends on *how* you want the diff
> > output to be in "converted in XML".
>
> > Michele
>
> The problem is, i'm dealing with verylargefileshere, 75+MB - 1GB+,
> and the only utility that seems to be able to compare these is bdiff
> (I'm on the Solaris platform).
>
> Can Text::Diff handle very large files?
>
> I'll try it out still. Thanks!
It turns out Text::Diff is taking a little too long to compare two
77MB files.
Does Perl provide any way to diff very large files?
------------------------------
Date: Tue, 26 Jun 2007 20:53:38 +0200
From: Michele Dondi <bik.mido@tiscalinet.it>
Subject: Re: Converting Diff Output to XML?
Message-Id: <34o2835a6oaq7t220717geclvadb63a6bo@4ax.com>
On Tue, 26 Jun 2007 18:22:57 -0000, Debajit Adhikary
<debajit1@gmail.com> wrote:
>It turns out Text::Diff is taking a little too long to compare two
>77MB files.
>Does Perl provide any way to diff very large files?
77Mb files do not look like generic ones. Are they plain text? What
kind of diff algorithm do you have in mind? Did you additionally check
CPAN? Lots of gems abound there anyway!
Michele
--
{$_=pack'B8'x25,unpack'A8'x32,$a^=sub{pop^pop}->(map substr
(($a||=join'',map--$|x$_,(unpack'w',unpack'u','G^<R<Y]*YB='
.'KYU;*EVH[.FHF2W+#"\Z*5TI/ER<Z`S(G.DZZ9OX0Z')=~/./g)x2,$_,
256),7,249);s/[^\w,]/ /g;$ \=/^J/?$/:"\r";print,redo}#JAPH,
------------------------------
Date: Tue, 26 Jun 2007 18:52:05 GMT
From: "Jürgen Exner" <jurgenex@hotmail.com>
Subject: Re: executing bash comands with pipe
Message-Id: <pfdgi.1795$%w5.1018@trndny04>
Fred wrote:
> I am trying to convert some bash scripts to perl. How can I execute
> the bash sequence below:
That would not be a particularly good idea because then you would still be
using Perl as a (poor) shell substitute.
I suggest to write a genuine Perl program instead.
> vxdmpadm listctlr all
No idea what vxdmpadm does, you may have to call that one as an external
program using backticks such that you can capture its output.
| grep GENESIS
Perl has its own buildin grep() function, no need to launch an external
process
| awk '/ENABLE/ {print $1}' |
No idea what this awk command does in detail, but it's pretty simply to
replicate the functionality in native Perl.
> sort -t c -k 2,3n
Perl has its own buildin sort() function, no need to launch an external
process
| tr "\n" " "
Perl has its own buildin tr() function, no need to launch an external
process
jue
------------------------------
Date: Tue, 26 Jun 2007 20:41:19 +0200
From: Michele Dondi <bik.mido@tiscalinet.it>
Subject: Re: FAQ 1.6 What is perl6?
Message-Id: <a9n2835352vigqo0fvk6lbjcgnbmghmrak@4ax.com>
On Tue, 26 Jun 2007 09:36:01 -0700, "Clenna Lumina"
<savagebeaste@yahoo.com> wrote:
>> OTOH I
>> know I've received help and wisdom from him, and he's been courteous
>> and respectful in my regards,
>
>Again, he provoked the argument of my typing skills, I'd hardly call
>that "courteous and respectful", rather I'd describe it as attempting to
>pick a fight.
I'd describe it as sarcasm. And it makes me laugh. It's nice to laugh.
C'mon, try yourself!
>> nothing of which I can say about you, period.
>
>Excuse me while I laugh hysterically a moment. How in the name of
>Socrates' oatmeal pudding did we go from typographical-error to me being
>anti "courteous and respectful"? Can YOU really say YOU & Tad have been
>"courteous and respectful" in your crusade against me?
If I have been unrespectful, then I apologize, but if I have been it
was only in pointing out how I perceived you to be unrespectful to me,
as one of the potential recipients of your post. To me one that
doesn't even care to check that what he writes is clearly
understandable is... well... uhm... unrespectful.
Michele
--
{$_=pack'B8'x25,unpack'A8'x32,$a^=sub{pop^pop}->(map substr
(($a||=join'',map--$|x$_,(unpack'w',unpack'u','G^<R<Y]*YB='
.'KYU;*EVH[.FHF2W+#"\Z*5TI/ER<Z`S(G.DZZ9OX0Z')=~/./g)x2,$_,
256),7,249);s/[^\w,]/ /g;$ \=/^J/?$/:"\r";print,redo}#JAPH,
------------------------------
Date: Tue, 26 Jun 2007 20:44:10 +0200
From: Michele Dondi <bik.mido@tiscalinet.it>
Subject: Re: FAQ 1.6 What is perl6?
Message-Id: <8gn2831hncu8fvnhkd8j0696mdu5v4u73u@4ax.com>
On Tue, 26 Jun 2007 09:39:46 -0700, "Clenna Lumina"
<savagebeaste@yahoo.com> wrote:
>>> seen soem regualars reepatedly tell people not to reinvent whats
>>> already
>> ^^ ^ ^^ ^^
>> ^^ ^ ^^ ^^
>> 1 2 3 4
>>
>> In one line...
>
>So what? They are just typos. You still haven't answered how this
Four typos out of ten words denote carelessness. Believe me, in Italy
there's been fascism: their motto was "I don't give a fuck". That
pretty much describes their POV. OTOH the opposite is "I CARE". I
CARE!
Michele
--
{$_=pack'B8'x25,unpack'A8'x32,$a^=sub{pop^pop}->(map substr
(($a||=join'',map--$|x$_,(unpack'w',unpack'u','G^<R<Y]*YB='
.'KYU;*EVH[.FHF2W+#"\Z*5TI/ER<Z`S(G.DZZ9OX0Z')=~/./g)x2,$_,
256),7,249);s/[^\w,]/ /g;$ \=/^J/?$/:"\r";print,redo}#JAPH,
------------------------------
Date: Tue, 26 Jun 2007 20:51:05 +0200
From: Michele Dondi <bik.mido@tiscalinet.it>
Subject: Re: FAQ 1.6 What is perl6?
Message-Id: <apn28310i498hc21e3m9ct3868h3e5rfhl@4ax.com>
On Tue, 26 Jun 2007 09:57:27 -0700, "Clenna Lumina"
<savagebeaste@yahoo.com> wrote:
>> No, by any means.
>
>I could sware there was, while else would:
>
> $ perl -le 'use strict; &somesub;'
> Undefined subroutine &main::somesub called at -e line 1.
>
>vs
>
> $ perl -le 'use strict; package TEST; &somesub;'
> Undefined subroutine &TEST::somesub called at -e line 1.
>
>Maybe I'm confusing two different things here but it appear as if there
>is a implicit main:: package, or am I missing something?
Yes, but this has nothing to do with a magic package in Perl 6 which
will hold the variables that are lexical to a scope. This way, the two
different variable systems will become one again. PadWalker
notwithstanding, this is a feature I'd really like to see leak back in
Perl 5.
>> Which style?
>
>The (more proper?) way of writing 'my' and 'our' and such as you were,
>as C<my>, C<our>, etc.
Oh, (pseudo-)POD. With function names I disambiguate in text with a
pair of parentheses, but with these keyword I prefer the somewhat
heavier markup to avoid confusion.
Michele
--
{$_=pack'B8'x25,unpack'A8'x32,$a^=sub{pop^pop}->(map substr
(($a||=join'',map--$|x$_,(unpack'w',unpack'u','G^<R<Y]*YB='
.'KYU;*EVH[.FHF2W+#"\Z*5TI/ER<Z`S(G.DZZ9OX0Z')=~/./g)x2,$_,
256),7,249);s/[^\w,]/ /g;$ \=/^J/?$/:"\r";print,redo}#JAPH,
------------------------------
Date: Tue, 26 Jun 2007 21:14:06 +0200
From: Mark Clements <mark.clementsREMOVETHIS@wanadoo.fr>
Subject: Re: gcc help
Message-Id: <4681657e$0$5085$ba4acef3@news.orange.fr>
rogv24@yahoo.com wrote:
> I need to download gcc for a solaris server then recompile perl with
> gcc.
>
> I have never done this. Can some one recommend a download website.
> Once the module is downloaded
> How do I recompile with perl.
>
> thanks
>
Various opensource distributions can be downloaded as Solaris packages from
http://www.sunfreeware.com
Note that a lot of them are also now provided on the Solaris
distribution CDs/DVDs.
Mark
------------------------------
Date: Tue, 26 Jun 2007 20:23:23 +0200
From: Gunnar Hjalmarsson <noreply@gunnar.cc>
Subject: Re: How to replace the "\" in "C:\myrootr\folder" with "/" ?
Message-Id: <5ed42dF383f47U1@mid.individual.net>
sv2021@gmail.com wrote:
> I want to replace the "\" backslash character in a string e.g: my
> $test = "C:\myroot\folder"; with forward slash "/"
That needs to be written
my $test = "C:\\myroot\\folder";
or
my $test = 'C:\myroot\folder';
--
Gunnar Hjalmarsson
Email: http://www.gunnar.cc/cgi-bin/contact.pl
------------------------------
Date: Tue, 26 Jun 2007 20:23:28 +0200
From: Gunnar Hjalmarsson <noreply@gunnar.cc>
Subject: Re: How to replace the "\" in "C:\myrootr\folder" with "/" ?
Message-Id: <5ed42iF383f47U2@mid.individual.net>
Asim Suter wrote:
> <sv2021@gmail.com> wrote:
>> I want to replace the "\" backslash character in a string e.g: my
>> $test = "C:\myroot\folder"; with forward slash "/"
>>
>> This is what my snippet, which seems to be not doing anything....
>> $test =~ s|\|/|g;
>
> Replace the \ by \\ in the substitution.
Or even better: use the more suitable and more efficient tr/// operator:
$test =~ tr|\\|/|;
> As \ has special special meaning - you need to "escape" it.
--
Gunnar Hjalmarsson
Email: http://www.gunnar.cc/cgi-bin/contact.pl
------------------------------
Date: Tue, 26 Jun 2007 19:02:27 GMT
From: "Jürgen Exner" <jurgenex@hotmail.com>
Subject: Re: How to replace the "\" in "C:\myrootr\folder" with "/" ?
Message-Id: <7pdgi.6465$G85.3752@trndny08>
sv2021@gmail.com wrote:
> I want to replace the "\" backslash character in a string e.g: my
> $test = "C:\myroot\folder"; with forward slash "/"
Do you really have a file that is named
c:myroot[formfeed]older
where [formfeed] indicates the form feed character?
Or did you mean
$test = 'C:\myroot\folder';
If so, then please be advised that using backward slashes in filenames is
not a bad idea (you just saw one reason why) and you should use forward
slashes instead, even on Windows which will happily work with forward
slashes, too.
> This is what my snippet, which seems to be not doing anything....
> $test =~ s|\|/|g;
Really? For me it is generating two error messages:
Unrecognized escape \m passed through at [...]
Substitution replacement not terminated at [...]
You didn't get those?
Your substitute command will replace globally a vertical bar followed by a
forward slash against .... well, you didn't write the substitution string.
Did you mean
$test =~ s|\\|/|g;
instead?
Anyway, for this kind of transliteration the tr() command is more suitable:
$test =~ tr|\\|/|;
jue
------------------------------
Date: Tue, 26 Jun 2007 11:59:00 -0700
From: Keith Keller <kkeller-usenet@wombat.san-francisco.ca.us>
Subject: Re: Perl Best Practices - Code Formatting.
Message-Id: <l848l4x4l3.ln2@goaway.wombat.san-francisco.ca.us>
On 2007-06-26, Charlton Wilbur <cwilbur@chromatico.net> wrote:
>
> "Transubstantiation? Consubstantiation? Heck, we don't know, we just
> do it because He said so, and we think that getting together to
> worship is a good thing."
I'm glad the thread has gotten back to Perl best practices. ;-)
--keith
--
kkeller-usenet@wombat.san-francisco.ca.us
(try just my userid to email me)
AOLSFAQ=http://www.therockgarden.ca/aolsfaq.txt
see X- headers for PGP signature information
------------------------------
Date: Tue, 26 Jun 2007 12:15:53 -0700
From: michaelzhao <mzhao1@gmail.com>
Subject: Problem with PERL function
Message-Id: <1182885353.761964.91310@g4g2000hsf.googlegroups.com>
Hey,
I am making a program to tally up the nucleic acid bases of E. Coli.
This data will be used in bioinformatics research to generate a Markov
Matrix.
However, I am just beginning PERL and ran into a slight problem.
Basically, I need the frequencies of the 4 bases, Adenosine (A),
Thymine (T), Cytosine (C), and Guanine (G). I made a PERL script to
tally up the total counts of the bases. In my case, there are 6254
Adenosine, 4957 Thymine, 4245 Cytosine, and 3534 Guanine.
In order to find the frequencies, all I would do is divide each base
count by the total.
However, here is my problem. Instead of doing it globally. I need to
be able to specify an arbitrary start and stop position to start
tallying the occurences of the bases and also to find the frequencies
of the bases in that particularly defined area.
Herein lies my problem. I have not a clue how to go about doing this
task. I've been looking online for a solution but haven't really found
one. If anyone can suggest an idea or function(s) I could use to go
about doing this task. I would be much obliged. Thanks!
~Michael
------------------------------
Date: Tue, 26 Jun 2007 12:23:58 -0700
From: Paul Lalli <mritty@gmail.com>
Subject: Re: Problem with PERL function
Message-Id: <1182885838.145909.81900@c77g2000hse.googlegroups.com>
On Jun 26, 3:15 pm, michaelzhao <mzh...@gmail.com> wrote:
> I am making a program to tally up the nucleic acid bases of E. Coli.
> This data will be used in bioinformatics research to generate a Markov
> Matrix.
>
> However, I am just beginning PERL and ran into a slight problem.
The language's name is "Perl", not PERL
> Basically, I need the frequencies of the 4 bases, Adenosine (A),
> Thymine (T), Cytosine (C), and Guanine (G). I made a PERL script to
> tally up the total counts of the bases. In my case, there are 6254
> Adenosine, 4957 Thymine, 4245 Cytosine, and 3534 Guanine.
>
> In order to find the frequencies, all I would do is divide each base
> count by the total.
>
> However, here is my problem. Instead of doing it globally. I need to
> be able to specify an arbitrary start and stop position to start
> tallying the occurences of the bases and also to find the frequencies
> of the bases in that particularly defined area.
>
> Herein lies my problem. I have not a clue how to go about doing this
> task. I've been looking online for a solution but haven't really found
> one. If anyone can suggest an idea or function(s) I could use to go
> about doing this task. I would be much obliged. Thanks!
You've given no indication of any kind as to how you're reading these
values, from what sort of data they're coming, in what way you're
scanning that data to pull out the values you want. So how is anyone
to know how to modify your program to only get certain of those
values?
Please par your problem down to a SHORT but COMPLETE script that
demonstrates your issue, and post that.
In the meantime, my random shot in the dark is that you want the $.
variable. Read about it in `perldoc perlop`.
Paul Lalli
------------------------------
Date: Tue, 26 Jun 2007 19:53:46 -0000
From: usenet@DavidFilmer.com
Subject: Re: Problem with PERL function
Message-Id: <1182887626.592196.93840@g37g2000prf.googlegroups.com>
On Jun 26, 12:15 pm, michaelzhao <mzh...@gmail.com> wrote:
> Basically, I need the frequencies of the 4 bases, Adenosine (A),
> Thymine (T), Cytosine (C), and Guanine (G).
> However, here is my problem. Instead of doing it globally. I need to
> be able to specify an arbitrary start and stop position
I don't know bioperl (and there are LOTS of modules related to
bioperl; maybe one does exactly what/how you want) but if all you want
to do is basic frequency analysis on an array (assuming your bases are
in an array) then there are several statistics packages that will do
this for you. Consider:
#!/usr/bin/perl
use strict;
use warnings;
use Statistics::Frequency;
my @dna = qw{ T C G A T T T T C C C C G G G G A A A A A A A A};
my $freq = Statistics::Frequency->new( @dna );
printf ( "\nAnalyzing %s bases\n\n", $freq->frequencies_sum() );
map { printf("%s Frequency is %s\n",
$_,
$freq->frequency($_) || 'undefined',
)
} qw {T C A G}
__END__
If you want to specify an arbitrary range, just slice the array, such
as:
my $freq = Statistics::Frequency->new( @dna[4..9] );
(remember arrays start numbering at zero, so this will get the fifth-
tenth items)
--
The best way to get a good answer is to ask a good question.
David Filmer (http://DavidFilmer.com)
------------------------------
Date: Tue, 26 Jun 2007 19:57:48 GMT
From: "John W. Krahn" <dummy@example.com>
Subject: Re: Problem with PERL function
Message-Id: <0degi.8627$qC1.8584@edtnps89>
michaelzhao wrote:
>
> I am making a program to tally up the nucleic acid bases of E. Coli.
> This data will be used in bioinformatics research to generate a Markov
> Matrix.
>
> However, I am just beginning PERL and ran into a slight problem.
>
> Basically, I need the frequencies of the 4 bases, Adenosine (A),
> Thymine (T), Cytosine (C), and Guanine (G). I made a PERL script to
> tally up the total counts of the bases. In my case, there are 6254
> Adenosine, 4957 Thymine, 4245 Cytosine, and 3534 Guanine.
>
> In order to find the frequencies, all I would do is divide each base
> count by the total.
>
> However, here is my problem. Instead of doing it globally. I need to
> be able to specify an arbitrary start and stop position to start
> tallying the occurences of the bases and also to find the frequencies
> of the bases in that particularly defined area.
>
> Herein lies my problem. I have not a clue how to go about doing this
> task. I've been looking online for a solution but haven't really found
> one. If anyone can suggest an idea or function(s) I could use to go
> about doing this task. I would be much obliged. Thanks!
You can use substr() to define a smaller area inside a string:
$ perl -le'
my $string =
q[ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG];
my $area = \substr $string, 23, 35;
my $Thymine_area = $$area =~ tr/A//;
my $Thymine_total = $string =~ tr/A//;
print for length( $string ), $Thymine_total, length( $$area ), $Thymine_area;
'
128
32
35
9
John
--
Perl isn't a toolbox, but a small machine shop where you
can special-order certain sorts of tools at low cost and
in short order. -- Larry Wall
------------------------------
Date: Tue, 26 Jun 2007 11:50:12 -0700
From: Joe Smith <joe@inwap.com>
Subject: Re: sort function, in non-standard cases
Message-Id: <oLednV5LSqJ4whzbnZ2dnUVZ_gmdnZ2d@comcast.com>
John W. Krahn wrote:
> That should be Guttman-Rosler.
>
> http://www.sysarch.com/Perl/sort_paper.html
Thanks for the link.
-Joe
------------------------------
Date: Tue, 26 Jun 2007 11:52:24 -0700
From: Joe Smith <joe@inwap.com>
Subject: Re: sort function, in non-standard cases
Message-Id: <oLednVlLSqL3_RzbnZ2dnUVZ_gmdnZ2d@comcast.com>
John W. Krahn wrote:
> Joe Smith wrote:
> You only need to stat the files once:
>
> my @typed_names =
> map {substr $_,1}
> sort
> map { -l $_ ? "l$_" : -d _ ? "d$_" : "r$_"}
> @ARGV;
D'oh! I usually use _, but forgot it that time. (Up too late at night.)
-Joe
------------------------------
Date: Tue, 26 Jun 2007 12:49:21 -0700
From: mfrost8@gmail.com
Subject: Re: strings with formatted characters in %ARGV
Message-Id: <1182887361.787464.272650@m36g2000hse.googlegroups.com>
On Jun 25, 6:56 pm, Tad McClellan <t...@seesig.invalid> wrote:
> mfro...@gmail.com <mfro...@gmail.com> wrote:
>
> > What do I need to do to make this work the way I expect it to?
>
> $foo =~ s/\\n/\n/g;
>
> --
> Tad McClellan
> email: perl -le "print scalar reverse qq/moc.noitatibaher\100cmdat/"
Thanks much for the many responses I received. I genuinely appreciate
you folks taking the time time help me out with this.
After my last post, I played around some more and came up with the
code shown above that I had found worked as well. However, what I was
hoping for was something more general purpose that allowed me to
replace all or at least multiple metacharacters in one go. I'm not
quite able to come up with something that will work here. I've tried
$foo =~ s/(\\[nrt])/$1/eeg;
which yields a bunch of
Use of uninitialized value in substitution iterator at ...
lines. It appears to me that I'm not making a match there, but I'm
not sure why. If it's data, then perl should just see '\t' as 2
characters.
In this case, I'm wondering if I need the eval's in the regex. If I
drop them, however, I don't get the errors, but I get the same output
repeated (i.e. no substitutions).
Mark
------------------------------
Date: Tue, 26 Jun 2007 21:29:48 +0200
From: "Kjetil S. Matheussen" <k.s.matheussen@notam02.no>
Subject: Re: The Modernization of Emacs: terminology buffer and keybinding
Message-Id: <Pine.LNX.4.64.0706262114320.9090@ttleush>
On Tue, 26 Jun 2007, Bjorn Borud wrote:
> [Robert Uhl <eadmund42@NOSPAMgmail.com>]
> |
> | Agreed. Stallman got sidetracked by Scheme, which IMHO was a
> | dead-end.
>
> too many people buying SICP and believing what they heard about it
> being an important book. I too spent some time exploring Scheme, or
> should I say, wasted some time, years ago, and nothing came of it
> other than a profound irritation.
>
Did you expect something specific before starting to read that
book? Thats a failure. SICP is a book you should read just for pure
pleasure.
> these people seemed to be
> completely disconnected from reality.
Please don't write things like that without backing it up with some
reason.
------------------------------
Date: 6 Apr 2001 21:33:47 GMT (Last modified)
From: Perl-Users-Request@ruby.oce.orst.edu (Perl-Users-Digest Admin)
Subject: Digest Administrivia (Last modified: 6 Apr 01)
Message-Id: <null>
Administrivia:
#The Perl-Users Digest is a retransmission of the USENET newsgroup
#comp.lang.perl.misc. For subscription or unsubscription requests, send
#the single line:
#
# subscribe perl-users
#or:
# unsubscribe perl-users
#
#to almanac@ruby.oce.orst.edu.
NOTE: due to the current flood of worm email banging on ruby, the smtp
server on ruby has been shut off until further notice.
To submit articles to comp.lang.perl.announce, send your article to
clpa@perl.com.
#To request back copies (available for a week or so), send your request
#to almanac@ruby.oce.orst.edu with the command "send perl-users x.y",
#where x is the volume number and y is the issue number.
#For other requests pertaining to the digest, send mail to
#perl-users-request@ruby.oce.orst.edu. Do not waste your time or mine
#sending perl questions to the -request address, I don't have time to
#answer them even if I did know the answer.
------------------------------
End of Perl-Users Digest V11 Issue 584
**************************************
