[30644] in Perl-Users-Digest
Perl-Users Digest, Issue: 1889 Volume: 11
daemon@ATHENA.MIT.EDU (Perl-Users Digest)
Tue Sep 30 06:23:38 2008
Date: Tue, 30 Sep 2008 03:09:09 -0700 (PDT)
From: Perl-Users Digest <Perl-Users-Request@ruby.OCE.ORST.EDU>
To: Perl-Users@ruby.OCE.ORST.EDU (Perl-Users Digest)
Perl-Users Digest Tue, 30 Sep 2008 Volume: 11 Number: 1889
Today's topics:
Handling Huge Data <v3gupta@gmail.com>
Re: Help: Process many files at the same time <mgjv@tradingpost.com.au>
Huge Data Handling <v3gupta@gmail.com>
Re: Huge Data Handling <bugbear@trim_papermule.co.uk_trim>
Re: Huge Data Handling <someone@example.com>
new CPAN modules on Tue Sep 30 2008 (Randal Schwartz)
Posting Guidelines for comp.lang.perl.misc ($Revision: tadmc@seesig.invalid
Question about regex (nagios plugin) <xml.devel@gmail.com>
Re: Question about regex (nagios plugin) <tim@burlyhost.com>
Re: Question about regex (nagios plugin) <tim@burlyhost.com>
Re: Question about regex (nagios plugin) <tim@burlyhost.com>
Re: Question about regex (nagios plugin) <peter@makholm.net>
Re: Question about regex (nagios plugin) <mgjv@tradingpost.com.au>
Digest Administrivia (Last modified: 6 Apr 01) (Perl-Users-Digest Admin)
----------------------------------------------------------------------
Date: Tue, 30 Sep 2008 01:01:55 -0700 (PDT)
From: Vishal G <v3gupta@gmail.com>
Subject: Handling Huge Data
Message-Id: <56a5ca30-514d-4913-973e-8422629872e4@l42g2000hsc.googlegroups.com>
Hi Guys,
I am trying to edit some bioinformatic package written in perl which
was written to handle DNA sequence of about 500,000 base long (a
string containg 500000 chrs)..
I have to enhance it to handle 100 million base long DNA...
Each base in DNA has this information, base (A, C, G or T), qual
(0-99), position (1-length)
there is one main DNA sequence and on average 500,000 parts (max 2000
chrs long with the same set of information)...
The program first creates an alignment like
<code>
*
Main - .....ACCCTTTGTCTAGTCGTATCGTCGATCGTCGCTAGCTCTGCT....
Part -
GTCGTATCGTCGAACGTCGCTAGCTC
Part - CTTTGTCTAGTCGTATCGTCGATCGTCGCT
Part
-
TCGAACGTCGCTAGC
</code>
Now, lets say I have to go thorugh each position and find how many
variations are present at certain position (with their original
position and quality).
Look at * position, there is T-A variation
Right now they are using hash to caputure this
%A, %C, %G, %T
Loop For Main DNA {
$T{$pos} = $qual;
# this tells me that there is T base at certain position with some
qual
}
Update the qual by adding the qual of parts
Loop For Parts {
$A{$pos} += $qual # for A parts
$T{$pos} += $qual $ for T parts
}
But because the dataset is huge, it consumes lot of memory...
so basically I am trying to figure out a way to store this information
without using much memory
If you dont understand the above problem, dont worry....
just tell me how to handle huge data which need to accessed frequently
using least possible memory..
Thanks in advance
------------------------------
Date: Tue, 30 Sep 2008 15:31:23 +1000
From: Martien Verbruggen <mgjv@tradingpost.com.au>
Subject: Re: Help: Process many files at the same time
Message-Id: <bjdsbg.b5i.ln@news.heliotrope.home>
On Tue, 30 Sep 2008 11:26:09 +0800,
Amy Lee <openlinuxsource@gmail.com> wrote:
> Hello,
>
> Here's my codes:
>
> foreach $file (@ARGV)
> {
> while (<>)
> {
If you want to read all files on the command line, one after the other,
simply use
while (<>) { }
There's no need to process @ARGV yourself for that.
See the perlop documentation. Look for the section starting with
The null filehandle <> is special: it can be used to emulate the behavā
ior of sed and awk
> Then I hope I can get a list of the result because I use "foreach" to
> process many files I gave at the same time. However, It just output one
> file and the output variable $CG is wrong. If I run this to process one
> file, it could work well.
I don't believe this. Even with the useless foreach loop around the
while loop, all files on the command line still should have been
processed.
This:
#!/usr/bin/perl
use strict;
use warnings;
foreach my $file (@ARGV)
{
while (<>)
{
print;
}
}
Works fine for me, and simply prints the contents of every file I give
it on the command line to STDOUT. It does this on the FIRST iteration of
the foreach loop. After this first iteration, @ARGV is empty, so there
is no second iteration. Since you're not supposed to modify arrays while
you're iterating over them, I suppose that this is current behaviour,
and not necessarily guaranteed. in other words: Don't do it. Either
iterate over @ARGV and handle the files yourself, or use while(<>), and
let it iterate.
Martien
--
|
Martien Verbruggen | Make it idiot proof and someone will make a
| better idiot.
|
------------------------------
Date: Tue, 30 Sep 2008 00:54:39 -0700 (PDT)
From: Vishal G <v3gupta@gmail.com>
Subject: Huge Data Handling
Message-Id: <6ccd6929-4b82-4c97-b085-a51c690f9395@k7g2000hsd.googlegroups.com>
Hi Guys,
I am trying to edit some bioinformatic package written in perl which
was written to handle DNA sequence of about 500,000 base long (a
string containg 500000 chrs)..
I have to enhance it to handle 100 million base long DNA...
Each base in DNA has this information, base (A, C, G or T), qual
(0-99), position (1-length)
there is one main DNA sequence and on average 500,000 parts (max 2000
chrs long with the same set of information)...
The program first creates an alignment like
*
Main - .....ACCCTTTGTCTAGTCGTATCGTCGATCGTCGCTAGCTCTGCT....
Part -
GTCGTATCGTCGAACGTCGCTAGCTC
Part - CTTTGTCTAGTCGTATCGTCGATCGTCGCT
Part
-
TCGAACGTCGCTAGCTCTG
Now, lets say I have to go thorugh each position and find how many
variations are present at certain position (with their original
position and quality).
Look at * position, there is T-A variation
Right now they are using hash to caputure this
%A, %C, %G, %T
Loop For Main DNA {
$A{$pos} = $qual; # this tells
me that there is A base at certain position
with some qual for main
}
Update the qual by adding the qual of parts
Loop For Parts {
$A{$pos} += $qual # for A parts
$T{$pos} += $qual $ for T parts
}
But because the dataset is huge, it consumes lot of memory...
so basically I am trying to figure out a way to store this information
without using much memory
If you dont understand the above problem, dont worry....
just tell me how to handle huge data which need to accessed frequently
using least possible memory..
Thanks in advance
------------------------------
Date: Tue, 30 Sep 2008 09:38:52 +0100
From: bugbear <bugbear@trim_papermule.co.uk_trim>
Subject: Re: Huge Data Handling
Message-Id: <idudneHnKZUBeHzVnZ2dneKdnZydnZ2d@posted.plusnet>
Vishal G wrote:
>
> just tell me how to handle huge data which need to accessed frequently
> using least possible memory..
Oh is that all!?
BugBear
------------------------------
Date: Tue, 30 Sep 2008 02:35:37 -0700
From: "John W. Krahn" <someone@example.com>
Subject: Re: Huge Data Handling
Message-Id: <IpmEk.3811$YN5.1969@newsfe03.iad>
Vishal G wrote:
>
> just tell me how to handle huge data which need to accessed frequently
> using least possible memory..
perldoc -q "How can I make my Perl program take less memory"
John
--
Perl isn't a toolbox, but a small machine shop where you
can special-order certain sorts of tools at low cost and
in short order. -- Larry Wall
------------------------------
Date: Tue, 30 Sep 2008 04:42:23 GMT
From: merlyn@stonehenge.com (Randal Schwartz)
Subject: new CPAN modules on Tue Sep 30 2008
Message-Id: <K7zrqn.21A6@zorch.sf-bay.org>
The following modules have recently been added to or updated in the
Comprehensive Perl Archive Network (CPAN). You can install them using the
instructions in the 'perlmodinstall' page included with your Perl
distribution.
Algorithm-TravelingSalesman-BitonicTour-0.05
http://search.cpan.org/~jtrammell/Algorithm-TravelingSalesman-BitonicTour-0.05/
solve the euclidean traveling-salesman problem with bitonic tours
----
AnyEvent-HTTP-1.05
http://search.cpan.org/~mlehmann/AnyEvent-HTTP-1.05/
simple but non-blocking HTTP/HTTPS client
----
Apache-Logmonster-3.05
http://search.cpan.org/~msimerson/Apache-Logmonster-3.05/
log utility for merging, sorting, and processing web logs
----
App-VW-0.01
http://search.cpan.org/~beppu/App-VW-0.01/
a deployment system for Squatting+Continuity web apps
----
BDB-1.801
http://search.cpan.org/~mlehmann/BDB-1.801/
Asynchronous Berkeley DB access
----
CGI-Application-Plugin-ActionDispatch-0.97
http://search.cpan.org/~jaywhy/CGI-Application-Plugin-ActionDispatch-0.97/
Perl extension
----
CPAN-1.92_66
http://search.cpan.org/~andk/CPAN-1.92_66/
query, download and build perl modules from CPAN sites
----
CPAN-Mini-Devel-0.03
http://search.cpan.org/~dagolden/CPAN-Mini-Devel-0.03/
Create CPAN::Mini mirror with developer releases
----
CPAN-Testers-ParseReport-0.0.11
http://search.cpan.org/~andk/CPAN-Testers-ParseReport-0.0.11/
parse reports to www.cpantesters.org from various sources
----
CPANPLUS-YACSmoke-0.16
http://search.cpan.org/~bingos/CPANPLUS-YACSmoke-0.16/
Yet Another CPANPLUS Smoke Tester
----
Catalyst-Authentication-Credential-OpenID-0.09
http://search.cpan.org/~ashley/Catalyst-Authentication-Credential-OpenID-0.09/
OpenID credential for Catalyst::Plugin::Authentication framework.
----
Catalyst-Authentication-Store-DBIx-Class-0.107
http://search.cpan.org/~jayk/Catalyst-Authentication-Store-DBIx-Class-0.107/
A storage class for Catalyst Authentication using DBIx::Class
----
Catalyst-Authenticaton-Store-Htpasswd-1.001
http://search.cpan.org/~bobtfish/Catalyst-Authenticaton-Store-Htpasswd-1.001/
----
Catalyst-Plugin-CHI-0.01
http://search.cpan.org/~fayland/Catalyst-Plugin-CHI-0.01/
CHI wrap of Catalyst
----
Catalyst-Plugin-CHI-0.02
http://search.cpan.org/~fayland/Catalyst-Plugin-CHI-0.02/
CHI wrap of Catalyst
----
Collection-0.38
http://search.cpan.org/~zag/Collection-0.38/
Collections framework for to CRUD data or objects.
----
Config-Model-0.628
http://search.cpan.org/~ddumont/Config-Model-0.628/
Framework to create configuration validation tools and editors
----
Config-Model-Xorg-0.513
http://search.cpan.org/~ddumont/Config-Model-Xorg-0.513/
Xorg configuration model for Config::Model
----
Coro-4.749
http://search.cpan.org/~mlehmann/Coro-4.749/
coroutine process abstraction
----
Devel-CheckOS-1.44
http://search.cpan.org/~dcantrell/Devel-CheckOS-1.44/
check what OS we're running on
----
Devel-PartialDump-0.07
http://search.cpan.org/~nuffin/Devel-PartialDump-0.07/
Partial dumping of data structures, optimized for argument printing.
----
Devel-StackBlech-0.04
http://search.cpan.org/~jjore/Devel-StackBlech-0.04/
Dumps your stack, all of it, somewhere
----
Document-Writer-0.09
http://search.cpan.org/~gphat/Document-Writer-0.09/
Library agnostic document creation
----
EV-3.44
http://search.cpan.org/~mlehmann/EV-3.44/
perl interface to libev, a high performance full-featured event loop
----
File-Assets-0.064
http://search.cpan.org/~rkrimen/File-Assets-0.064/
Manage .css and .js assets for a web page or application
----
File-Find-Rule-VCS-1.05
http://search.cpan.org/~adamk/File-Find-Rule-VCS-1.05/
Exclude files/directories for Version Control Systems
----
File-Stat-Moose-0.0201
http://search.cpan.org/~dexter/File-Stat-Moose-0.0201/
Status info for a file - Moose-based
----
Flickr-API-1.00
http://search.cpan.org/~iamcal/Flickr-API-1.00/
Perl interface to the Flickr API
----
Games-Risk-1.1.2
http://search.cpan.org/~jquelin/Games-Risk-1.1.2/
classical 'risk' board game
----
IMDB-Film-0.35
http://search.cpan.org/~stepanov/IMDB-Film-0.35/
OO Perl interface to the movies database IMDB.
----
Inline-Python-0.23
http://search.cpan.org/~nine/Inline-Python-0.23/
Write Perl subs and classes in Python.
----
JSON-XS-2.23
http://search.cpan.org/~mlehmann/JSON-XS-2.23/
JSON serialising/deserialising, done correctly and fast
----
MooseX-Storage-0.15
http://search.cpan.org/~bobtfish/MooseX-Storage-0.15/
An serialization framework for Moose classes
----
Mouse-0.09
http://search.cpan.org/~sartak/Mouse-0.09/
Moose minus the antlers
----
Music-Audioscrobbler-MPD-0.13
http://search.cpan.org/~ealleniii/Music-Audioscrobbler-MPD-0.13/
Module providing routines to submit songs to last.fm from MPD.
----
Net-BitTorrent-0.027_002
http://search.cpan.org/~sanko/Net-BitTorrent-0.027_002/
BitTorrent peer-to-peer protocol class
----
Net-BitTorrent-0.027_003
http://search.cpan.org/~sanko/Net-BitTorrent-0.027_003/
BitTorrent peer-to-peer protocol class
----
Net-Kotonoha-0.07
http://search.cpan.org/~mattn/Net-Kotonoha-0.07/
A perl interface to kotonoha.cc
----
Net-Kotonoha-0.08
http://search.cpan.org/~mattn/Net-Kotonoha-0.08/
A perl interface to kotonoha.cc
----
Net-Ping-Network-1.57
http://search.cpan.org/~angerstei/Net-Ping-Network-1.57/
A modul to ICMP-request nodes in networks very fast
----
Net-Z3950-ZOOM-1.25
http://search.cpan.org/~mirk/Net-Z3950-ZOOM-1.25/
Perl extension for invoking the ZOOM-C API.
----
Nginx-Control-0.01
http://search.cpan.org/~perigrin/Nginx-Control-0.01/
Simple class to manage a Nginx server
----
Parallel-Prefork-0.04
http://search.cpan.org/~kazuho/Parallel-Prefork-0.04/
A simple prefork server framework
----
Parse-Marpa-0.218000
http://search.cpan.org/~jkegl/Parse-Marpa-0.218000/
Generate Parsers from any BNF grammar
----
Perlanet-0.07
http://search.cpan.org/~davecross/Perlanet-0.07/
A program for creating web pages that aggregate web feeds (both RSS and Atom).
----
RPC-XML-0.64
http://search.cpan.org/~rjray/RPC-XML-0.64/
A set of classes for core data, message and XML handling
----
RTx-Tags-0.06
http://search.cpan.org/~jpierce/RTx-Tags-0.06/
----
Rose-DB-Object-0.7721
http://search.cpan.org/~jsiracusa/Rose-DB-Object-0.7721/
Extensible, high performance object-relational mapper (ORM).
----
Rose-DB-Object-0.7722
http://search.cpan.org/~jsiracusa/Rose-DB-Object-0.7722/
Extensible, high performance object-relational mapper (ORM).
----
Rose-DBx-Garden-Catalyst-0.10
http://search.cpan.org/~karman/Rose-DBx-Garden-Catalyst-0.10/
plant Roses in your Catalyst garden
----
SVN-Hooks-0.10.370
http://search.cpan.org/~gnustavo/SVN-Hooks-0.10.370/
A framework for implementing Subversion hooks.
----
SVN-S4-1.031
http://search.cpan.org/~wsnyder/SVN-S4-1.031/
Wrapper for Subversion
----
Scanner-0.02-5
http://search.cpan.org/~daleamon/Scanner-0.02-5/
----
Shell-Amazon-S3-0.04_01
http://search.cpan.org/~kitano/Shell-Amazon-S3-0.04_01/
Shell for Amazon S3
----
Sphinx-Control-0.01
http://search.cpan.org/~fayland/Sphinx-Control-0.01/
Simple class to manage a Sphinx searchd
----
Task-BeLike-FAYLAND-0.02
http://search.cpan.org/~fayland/Task-BeLike-FAYLAND-0.02/
Modules Fayland loves!
----
Task-BeLike-FAYLAND-0.03
http://search.cpan.org/~fayland/Task-BeLike-FAYLAND-0.03/
Modules Fayland loves!
----
Template-Teeny-0.00_002
http://search.cpan.org/~konobi/Template-Teeny-0.00_002/
Teeny-weeny templating system
----
Test-HTTP-Server-Simple-StashWarnings-0.02
http://search.cpan.org/~sartak/Test-HTTP-Server-Simple-StashWarnings-0.02/
catch your forked server's warnings
----
Tk-TextVi-0.0142
http://search.cpan.org/~jstrom/Tk-TextVi-0.0142/
Tk::Text widget with Vi-like commands
----
Variable-Magic-0.22
http://search.cpan.org/~vpit/Variable-Magic-0.22/
Associate user-defined magic to variables from Perl.
----
WWW-Search-Ebay-Europe-2.002
http://search.cpan.org/~mthurn/WWW-Search-Ebay-Europe-2.002/
----
WWW-Search-Ebay-Europe-2.003
http://search.cpan.org/~mthurn/WWW-Search-Ebay-Europe-2.003/
----
WWW-Search-Ebay-Europe-2.004
http://search.cpan.org/~mthurn/WWW-Search-Ebay-Europe-2.004/
----
WWW-UsePerl-Journal-0.22
http://search.cpan.org/~barbie/WWW-UsePerl-Journal-0.22/
A use.perl.org journal tool
----
WWW-UsePerl-Journal-Thread-0.11
http://search.cpan.org/~barbie/WWW-UsePerl-Journal-Thread-0.11/
Handles the retrieval of UsePerl journal comment threads.
----
WebService-Eulerian-Analytics-0.5
http://search.cpan.org/~mjondet/WebService-Eulerian-Analytics-0.5/
Eulerian Analytics API
----
libwww-perl-5.816
http://search.cpan.org/~gaas/libwww-perl-5.816/
----
openStatisticalServices-0.019
http://search.cpan.org/~rphaney/openStatisticalServices-0.019/
----
openStatisticalServices-0.020
http://search.cpan.org/~rphaney/openStatisticalServices-0.020/
----
openStatisticalServices-0.022
http://search.cpan.org/~rphaney/openStatisticalServices-0.022/
----
scriptname-0.6
http://search.cpan.org/~massa/scriptname-0.6/
Locate original perl script
If you're an author of one of these modules, please submit a detailed
announcement to comp.lang.perl.announce, and we'll pass it along.
This message was generated by a Perl program described in my Linux
Magazine column, which can be found on-line (along with more than
200 other freely available past column articles) at
http://www.stonehenge.com/merlyn/LinuxMag/col82.html
print "Just another Perl hacker," # the original
--
Randal L. Schwartz - Stonehenge Consulting Services, Inc. - +1 503 777 0095
<merlyn@stonehenge.com> <URL:http://www.stonehenge.com/merlyn/>
Smalltalk/Perl/Unix consulting, Technical writing, Comedy, etc. etc.
See http://methodsandmessages.vox.com/ for Smalltalk and Seaside discussion
------------------------------
Date: Tue, 30 Sep 2008 07:18:19 GMT
From: tadmc@seesig.invalid
Subject: Posting Guidelines for comp.lang.perl.misc ($Revision: 1.8 $)
Message-Id: <%okEk.1293$hc1.915@flpi150.ffdc.sbc.com>
Outline
Before posting to comp.lang.perl.misc
Must
- Check the Perl Frequently Asked Questions (FAQ)
- Check the other standard Perl docs (*.pod)
Really Really Should
- Lurk for a while before posting
- Search a Usenet archive
If You Like
- Check Other Resources
Posting to comp.lang.perl.misc
Is there a better place to ask your question?
- Question should be about Perl, not about the application area
How to participate (post) in the clpmisc community
- Carefully choose the contents of your Subject header
- Use an effective followup style
- Speak Perl rather than English, when possible
- Ask perl to help you
- Do not re-type Perl code
- Provide enough information
- Do not provide too much information
- Do not post binaries, HTML, or MIME
Social faux pas to avoid
- Asking a Frequently Asked Question
- Asking a question easily answered by a cursory doc search
- Asking for emailed answers
- Beware of saying "doesn't work"
- Sending a "stealth" Cc copy
Be extra cautious when you get upset
- Count to ten before composing a followup when you are upset
- Count to ten after composing and before posting when you are upset
-----------------------------------------------------------------
Posting Guidelines for comp.lang.perl.misc ($Revision: 1.8 $)
This newsgroup, commonly called clpmisc, is a technical newsgroup
intended to be used for discussion of Perl related issues (except job
postings), whether it be comments or questions.
As you would expect, clpmisc discussions are usually very technical in
nature and there are conventions for conduct in technical newsgroups
going somewhat beyond those in non-technical newsgroups.
The article at:
http://www.catb.org/~esr/faqs/smart-questions.html
describes how to get answers from technical people in general.
This article describes things that you should, and should not, do to
increase your chances of getting an answer to your Perl question. It is
available in POD, HTML and plain text formats at:
http://www.rehabitation.com/clpmisc.shtml
For more information about netiquette in general, see the "Netiquette
Guidelines" at:
http://andrew2.andrew.cmu.edu/rfc/rfc1855.html
A note to newsgroup "regulars":
Do not use these guidelines as a "license to flame" or other
meanness. It is possible that a poster is unaware of things
discussed here. Give them the benefit of the doubt, and just
help them learn how to post, rather than assume that they do
know and are being the "bad kind" of Lazy.
A note about technical terms used here:
In this document, we use words like "must" and "should" as
they're used in technical conversation (such as you will
encounter in this newsgroup). When we say that you *must* do
something, we mean that if you don't do that something, then
it's unlikely that you will benefit much from this group.
We're not bossing you around; we're making the point without
lots of words.
Do *NOT* send email to the maintainer of these guidelines. It will be
discarded unread. The guidelines belong to the newsgroup so all
discussion should appear in the newsgroup. I am just the secretary that
writes down the consensus of the group.
Before posting to comp.lang.perl.misc
Must
This section describes things that you *must* do before posting to
clpmisc, in order to maximize your chances of getting meaningful replies
to your inquiry and to avoid getting flamed for being lazy and trying to
have others do your work.
The perl distribution includes documentation that is copied to your hard
drive when you install perl. Also installed is a program for looking
things up in that (and other) documentation named 'perldoc'.
You should either find out where the docs got installed on your system,
or use perldoc to find them for you. Type "perldoc perldoc" to learn how
to use perldoc itself. Type "perldoc perl" to start reading Perl's
standard documentation.
Check the Perl Frequently Asked Questions (FAQ)
Checking the FAQ before posting is required in Big 8 newsgroups in
general, there is nothing clpmisc-specific about this requirement.
You are expected to do this in nearly all newsgroups.
You can use the "-q" switch with perldoc to do a word search of the
questions in the Perl FAQs.
Check the other standard Perl docs (*.pod)
The perl distribution comes with much more documentation than is
available for most other newsgroups, so in clpmisc you should also
see if you can find an answer in the other (non-FAQ) standard docs
before posting.
It is *not* required, or even expected, that you actually *read* all of
Perl's standard docs, only that you spend a few minutes searching them
before posting.
Try doing a word-search in the standard docs for some words/phrases
taken from your problem statement or from your very carefully worded
"Subject:" header.
Really Really Should
This section describes things that you *really should* do before posting
to clpmisc.
Lurk for a while before posting
This is very important and expected in all newsgroups. Lurking means
to monitor a newsgroup for a period to become familiar with local
customs. Each newsgroup has specific customs and rituals. Knowing
these before you participate will help avoid embarrassing social
situations. Consider yourself to be a foreigner at first!
Search a Usenet archive
There are tens of thousands of Perl programmers. It is very likely
that your question has already been asked (and answered). See if you
can find where it has already been answered.
One such searchable archive is:
http://groups.google.com/advanced_group_search
If You Like
This section describes things that you *can* do before posting to
clpmisc.
Check Other Resources
You may want to check in books or on web sites to see if you can
find the answer to your question.
But you need to consider the source of such information: there are a
lot of very poor Perl books and web sites, and several good ones
too, of course.
Posting to comp.lang.perl.misc
There can be 200 messages in clpmisc in a single day. Nobody is going to
read every article. They must decide somehow which articles they are
going to read, and which they will skip.
Your post is in competition with 199 other posts. You need to "win"
before a person who can help you will even read your question.
These sections describe how you can help keep your article from being
one of the "skipped" ones.
Is there a better place to ask your question?
Question should be about Perl, not about the application area
It can be difficult to separate out where your problem really is,
but you should make a conscious effort to post to the most
applicable newsgroup. That is, after all, where you are the most
likely to find the people who know how to answer your question.
Being able to "partition" a problem is an essential skill for
effectively troubleshooting programming problems. If you don't get
that right, you end up looking for answers in the wrong places.
It should be understood that you may not know that the root of your
problem is not Perl-related (the two most frequent ones are CGI and
Operating System related), so off-topic postings will happen from
time to time. Be gracious when someone helps you find a better place
to ask your question by pointing you to a more applicable newsgroup.
How to participate (post) in the clpmisc community
Carefully choose the contents of your Subject header
You have 40 precious characters of Subject to win out and be one of
the posts that gets read. Don't waste them. Take care while
composing them, they are the key that opens the door to getting an
answer.
Spend them indicating what aspect of Perl others will find if they
should decide to read your article.
Do not spend them indicating "experience level" (guru, newbie...).
Do not spend them pleading (please read, urgent, help!...).
Do not spend them on non-Subjects (Perl question, one-word
Subject...)
For more information on choosing a Subject see "Choosing Good
Subject Lines":
http://www.cpan.org/authors/id/D/DM/DMR/subjects.post
Part of the beauty of newsgroup dynamics, is that you can contribute
to the community with your very first post! If your choice of
Subject leads a fellow Perler to find the thread you are starting,
then even asking a question helps us all.
Use an effective followup style
When composing a followup, quote only enough text to establish the
context for the comments that you will add. Always indicate who
wrote the quoted material. Never quote an entire article. Never
quote a .signature (unless that is what you are commenting on).
Intersperse your comments *following* each section of quoted text to
which they relate. Unappreciated followup styles are referred to as
"top-posting", "Jeopardy" (because the answer comes before the
question), or "TOFU" (Text Over, Fullquote Under).
Reversing the chronology of the dialog makes it much harder to
understand (some folks won't even read it if written in that style).
For more information on quoting style, see:
http://web.presby.edu/~nnqadmin/nnq/nquote.html
Speak Perl rather than English, when possible
Perl is much more precise than natural language. Saying it in Perl
instead will avoid misunderstanding your question or problem.
Do not say: I have variable with "foo\tbar" in it.
Instead say: I have $var = "foo\tbar", or I have $var = 'foo\tbar',
or I have $var = <DATA> (and show the data line).
Ask perl to help you
You can ask perl itself to help you find common programming mistakes
by doing two things: enable warnings (perldoc warnings) and enable
"strict"ures (perldoc strict).
You should not bother the hundreds/thousands of readers of the
newsgroup without first seeing if a machine can help you find your
problem. It is demeaning to be asked to do the work of a machine. It
will annoy the readers of your article.
You can look up any of the messages that perl might issue to find
out what the message means and how to resolve the potential mistake
(perldoc perldiag). If you would like perl to look them up for you,
you can put "use diagnostics;" near the top of your program.
Do not re-type Perl code
Use copy/paste or your editor's "import" function rather than
attempting to type in your code. If you make a typo you will get
followups about your typos instead of about the question you are
trying to get answered.
Provide enough information
If you do the things in this item, you will have an Extremely Good
chance of getting people to try and help you with your problem!
These features are a really big bonus toward your question winning
out over all of the other posts that you are competing with.
First make a short (less than 20-30 lines) and *complete* program
that illustrates the problem you are having. People should be able
to run your program by copy/pasting the code from your article. (You
will find that doing this step very often reveals your problem
directly. Leading to an answer much more quickly and reliably than
posting to Usenet.)
Describe *precisely* the input to your program. Also provide example
input data for your program. If you need to show file input, use the
__DATA__ token (perldata.pod) to provide the file contents inside of
your Perl program.
Show the output (including the verbatim text of any messages) of
your program.
Describe how you want the output to be different from what you are
getting.
If you have no idea at all of how to code up your situation, be sure
to at least describe the 2 things that you *do* know: input and
desired output.
Do not provide too much information
Do not just post your entire program for debugging. Most especially
do not post someone *else's* entire program.
Do not post binaries, HTML, or MIME
clpmisc is a text only newsgroup. If you have images or binaries
that explain your question, put them in a publically accessible
place (like a Web server) and provide a pointer to that location. If
you include code, cut and paste it directly in the message body.
Don't attach anything to the message. Don't post vcards or HTML.
Many people (and even some Usenet servers) will automatically filter
out such messages. Many people will not be able to easily read your
post. Plain text is something everyone can read.
Social faux pas to avoid
The first two below are symptoms of lots of FAQ asking here in clpmisc.
It happens so often that folks will assume that it is happening yet
again. If you have looked but not found, or found but didn't understand
the docs, say so in your article.
Asking a Frequently Asked Question
It should be understood that you may have missed the applicable FAQ
when you checked, which is not a big deal. But if the Frequently
Asked Question is worded similar to your question, folks will assume
that you did not look at all. Don't become indignant at pointers to
the FAQ, particularly if it solves your problem.
Asking a question easily answered by a cursory doc search
If folks think you have not even tried the obvious step of reading
the docs applicable to your problem, they are likely to become
annoyed.
If you are flamed for not checking when you *did* check, then just
shrug it off (and take the answer that you got).
Asking for emailed answers
Emailed answers benefit one person. Posted answers benefit the
entire community. If folks can take the time to answer your
question, then you can take the time to go get the answer in the
same place where you asked the question.
It is OK to ask for a *copy* of the answer to be emailed, but many
will ignore such requests anyway. If you munge your address, you
should never expect (or ask) to get email in response to a Usenet
post.
Ask the question here, get the answer here (maybe).
Beware of saying "doesn't work"
This is a "red flag" phrase. If you find yourself writing that,
pause and see if you can't describe what is not working without
saying "doesn't work". That is, describe how it is not what you
want.
Sending a "stealth" Cc copy
A "stealth Cc" is when you both email and post a reply without
indicating *in the body* that you are doing so.
Be extra cautious when you get upset
Count to ten before composing a followup when you are upset
This is recommended in all Usenet newsgroups. Here in clpmisc, most
flaming sub-threads are not about any feature of Perl at all! They
are most often for what was seen as a breach of netiquette. If you
have lurked for a bit, then you will know what is expected and won't
make such posts in the first place.
But if you get upset, wait a while before writing your followup. I
recommend waiting at least 30 minutes.
Count to ten after composing and before posting when you are upset
After you have written your followup, wait *another* 30 minutes
before committing yourself by posting it. You cannot take it back
once it has been said.
AUTHOR
Tad McClellan and many others on the comp.lang.perl.misc newsgroup.
--
Tad McClellan
email: perl -le "print scalar reverse qq/moc.noitatibaher\100cmdat/"
------------------------------
Date: Mon, 29 Sep 2008 23:29:41 -0700 (PDT)
From: Ashish Kumar <xml.devel@gmail.com>
Subject: Question about regex (nagios plugin)
Message-Id: <1b5ce03c-e60e-4815-9b80-ff592e7be9ec@p25g2000hsf.googlegroups.com>
Hello,
I'm developing a plugin for nagios to get CPU usage on Red Hat Linux
machines. Below is a snippet:
-------------------- 8< --------------------
$get_cpu_util=`vmstat 1 2 | tail -n 1`;
# procs -----------memory---------- ---swap-- -----io---- --system--
----cpu----
# r b swpd free buff cache si so bi bo in cs
us sy id wa
# 2 0 0 4424156 181780 2505320 0 0 0 7 1
1 0 0 100 0
# 0 0 0 4426332 181780 2505320 0 0 0 48 1121
3762 0 0 100 0
if($get_cpu_util =~ /^.*\s+(\d+)\s+(\d+)\s+(\d+)\s+(\d+)\s*$/){
$us=$1;
$sy=$2;
$id=$3;
$wa=$4;
}
-------------------- 8< --------------------
The code runs fine on RHEL4 hosts and shows the correct values. But
in RHEL5 they have added one more value namely "st" in cpu section:
-------------------- 8< --------------------
procs -----------memory---------- ---swap-- -----io---- --system--
-----cpu------
r b swpd free buff cache si so bi bo in cs us
sy id wa st
0 0 33184 10028 66208 68396 0 0 737 276 15 12 34
9 51 7 0
0 0 33184 10028 66208 68396 0 0 0 32 1104 140 0
0 100 0 0
-------------------- 8< --------------------
So, I was just wondering if there is any way to run the same code run
on both hosts with some regex wizardry?
Thanks.
------------------------------
Date: Mon, 29 Sep 2008 23:53:13 -0700
From: Tim Greer <tim@burlyhost.com>
Subject: Re: Question about regex (nagios plugin)
Message-Id: <u1kEk.4100$891.1354@newsfe07.iad>
Ashish Kumar wrote:
> Hello,
>
> I'm developing a plugin for nagios to get CPU usage on Red Hat Linux
> machines. Below is a snippet:
>
> -------------------- 8< --------------------
> $get_cpu_util=`vmstat 1 2 | tail -n 1`;
>
> # procs -----------memory---------- ---swap-- -----io---- --system--
> ----cpu----
> # r b swpd free buff cache si so bi bo in cs
> us sy id wa
> # 2 0 0 4424156 181780 2505320 0 0 0 7 1
> 1 0 0 100 0
> # 0 0 0 4426332 181780 2505320 0 0 0 48 1121
> 3762 0 0 100 0
>
> if($get_cpu_util =~ /^.*\s+(\d+)\s+(\d+)\s+(\d+)\s+(\d+)\s*$/){
> $us=$1;
> $sy=$2;
> $id=$3;
> $wa=$4;
> }
> -------------------- 8< --------------------
>
> The code runs fine on RHEL4 hosts and shows the correct values. But
> in RHEL5 they have added one more value namely "st" in cpu section:
>
> -------------------- 8< --------------------
> procs -----------memory---------- ---swap-- -----io---- --system--
> -----cpu------
> r b swpd free buff cache si so bi bo in cs us
> sy id wa st
> 0 0 33184 10028 66208 68396 0 0 737 276 15 12 34
> 9 51 7 0
> 0 0 33184 10028 66208 68396 0 0 0 32 1104 140 0
> 0 100 0 0
> -------------------- 8< --------------------
>
> So, I was just wondering if there is any way to run the same code run
> on both hosts with some regex wizardry?
>
>
> Thanks.
You can add a check in the script to determine the OS version, or add an
optional last field and value (which if blank, you can assume is the
older OS version).
Just declare the variables before the regex and:
if ($get_cpu_util =~ /^.*\s+(\d+)\s+(\d+)\s+(\d+)\s+(\d+)\s*(\d+)?\s*$/)
{
$us = $1;
$sy = $2;
$id = $3;
$wa = $4;
$st = $5;
}
You'd want to do more checking than that, but that's a simple way to
show an example working off your existing code.
--
Tim Greer, CEO/Founder/CTO, BurlyHost.com, Inc.
Shared Hosting, Reseller Hosting, Dedicated & Semi-Dedicated servers
and Custom Hosting. 24/7 support, 30 day guarantee, secure servers.
Industry's most experienced staff! -- Web Hosting With Muscle!
------------------------------
Date: Mon, 29 Sep 2008 23:57:15 -0700
From: Tim Greer <tim@burlyhost.com>
Subject: Re: Question about regex (nagios plugin)
Message-Id: <f5kEk.4101$891.1311@newsfe07.iad>
Tim Greer wrote:
> Ashish Kumar wrote:
>
>> Hello,
>>
>> I'm developing a plugin for nagios to get CPU usage on Red Hat Linux
>> machines. Below is a snippet:
>>
>> -------------------- 8< --------------------
>> $get_cpu_util=`vmstat 1 2 | tail -n 1`;
>>
>> # procs -----------memory---------- ---swap-- -----io---- --system--
>> ----cpu----
>> # r b swpd free buff cache si so bi bo in cs
>> us sy id wa
>> # 2 0 0 4424156 181780 2505320 0 0 0 7 1
>> 1 0 0 100 0
>> # 0 0 0 4426332 181780 2505320 0 0 0 48 1121
>> 3762 0 0 100 0
>>
>> if($get_cpu_util =~ /^.*\s+(\d+)\s+(\d+)\s+(\d+)\s+(\d+)\s*$/){
>> $us=$1;
>> $sy=$2;
>> $id=$3;
>> $wa=$4;
>> }
>> -------------------- 8< --------------------
>>
>> The code runs fine on RHEL4 hosts and shows the correct values. But
>> in RHEL5 they have added one more value namely "st" in cpu section:
>>
>> -------------------- 8< --------------------
>> procs -----------memory---------- ---swap-- -----io---- --system--
>> -----cpu------
>> r b swpd free buff cache si so bi bo in cs us
>> sy id wa st
>> 0 0 33184 10028 66208 68396 0 0 737 276 15 12 34
>> 9 51 7 0
>> 0 0 33184 10028 66208 68396 0 0 0 32 1104 140 0
>> 0 100 0 0
>> -------------------- 8< --------------------
>>
>> So, I was just wondering if there is any way to run the same code run
>> on both hosts with some regex wizardry?
>>
>>
>> Thanks.
>
> You can add a check in the script to determine the OS version, or add
> an optional last field and value (which if blank, you can assume is
> the older OS version).
>
> Just declare the variables before the regex and:
>
> if ($get_cpu_util =~
> /^.*\s+(\d+)\s+(\d+)\s+(\d+)\s+(\d+)\s*(\d+)?\s*$/)
> {
> $us = $1;
> $sy = $2;
> $id = $3;
> $wa = $4;
> $st = $5;
> }
>
> You'd want to do more checking than that, but that's a simple way to
> show an example working off your existing code.
Pardon, I should have fixed your example (rather than add to it), as it
was broken. That would actually be:
if ($get_cpu_util =~ m/^.*\s+(\d+)\s+(\d+)\s+(\d+)\s+(\d+)\s*(\d+)
\s*$/) {
--
Tim Greer, CEO/Founder/CTO, BurlyHost.com, Inc.
Shared Hosting, Reseller Hosting, Dedicated & Semi-Dedicated servers
and Custom Hosting. 24/7 support, 30 day guarantee, secure servers.
Industry's most experienced staff! -- Web Hosting With Muscle!
------------------------------
Date: Tue, 30 Sep 2008 00:14:07 -0700
From: Tim Greer <tim@burlyhost.com>
Subject: Re: Question about regex (nagios plugin)
Message-Id: <vlkEk.603$ex3.72@newsfe02.iad>
Tim Greer wrote:
> Tim Greer wrote:
>
>> Ashish Kumar wrote:
>>
>>> Hello,
>>>
>>> I'm developing a plugin for nagios to get CPU usage on Red Hat Linux
>>> machines. Below is a snippet:
>>>
>>> -------------------- 8< --------------------
>>> $get_cpu_util=`vmstat 1 2 | tail -n 1`;
>>>
>>> # procs -----------memory---------- ---swap-- -----io---- --system--
>>> ----cpu----
>>> # r b swpd free buff cache si so bi bo in cs
>>> us sy id wa
>>> # 2 0 0 4424156 181780 2505320 0 0 0 7 1
>>> 1 0 0 100 0
>>> # 0 0 0 4426332 181780 2505320 0 0 0 48 1121
>>> 3762 0 0 100 0
>>>
>>> if($get_cpu_util =~ /^.*\s+(\d+)\s+(\d+)\s+(\d+)\s+(\d+)\s*$/){
>>> $us=$1;
>>> $sy=$2;
>>> $id=$3;
>>> $wa=$4;
>>> }
>>> -------------------- 8< --------------------
>>>
>>> The code runs fine on RHEL4 hosts and shows the correct values. But
>>> in RHEL5 they have added one more value namely "st" in cpu section:
>>>
>>> -------------------- 8< --------------------
>>> procs -----------memory---------- ---swap-- -----io---- --system--
>>> -----cpu------
>>> r b swpd free buff cache si so bi bo in cs us
>>> sy id wa st
>>> 0 0 33184 10028 66208 68396 0 0 737 276 15 12 34
>>> 9 51 7 0
>>> 0 0 33184 10028 66208 68396 0 0 0 32 1104 140 0
>>> 0 100 0 0
>>> -------------------- 8< --------------------
>>>
>>> So, I was just wondering if there is any way to run the same code
>>> run on both hosts with some regex wizardry?
>>>
>>>
>>> Thanks.
>>
>> You can add a check in the script to determine the OS version, or add
>> an optional last field and value (which if blank, you can assume is
>> the older OS version).
>>
>> Just declare the variables before the regex and:
>>
>> if ($get_cpu_util =~
>> /^.*\s+(\d+)\s+(\d+)\s+(\d+)\s+(\d+)\s*(\d+)?\s*$/)
>> {
>> $us = $1;
>> $sy = $2;
>> $id = $3;
>> $wa = $4;
>> $st = $5;
>> }
>>
>> You'd want to do more checking than that, but that's a simple way to
>> show an example working off your existing code.
>
> Pardon, I should have fixed your example (rather than add to it), as
> it
> was broken. That would actually be:
>
> if ($get_cpu_util =~ m/^.*\s+(\d+)\s+(\d+)\s+(\d+)\s+(\d+)\s*(\d+)
> \s*$/) {
>
>
In fact, that above example isn't really right anyway, working off the
code, because it will match either OS version's vmstat output, since
you are only capturing the last so-many digits, rather than a fixed
regex to count and ignore the first 11 digits and only catpure the last
5 or 6. There are a few ways to go about that. You can use split
instead of the regex, or use a regex in a few different ways. I'd
personally use split or a fixed field regex or something similar, or
just check the OS version to determine the regex/split used.
--
Tim Greer, CEO/Founder/CTO, BurlyHost.com, Inc.
Shared Hosting, Reseller Hosting, Dedicated & Semi-Dedicated servers
and Custom Hosting. 24/7 support, 30 day guarantee, secure servers.
Industry's most experienced staff! -- Web Hosting With Muscle!
------------------------------
Date: Tue, 30 Sep 2008 09:37:26 +0200
From: Peter Makholm <peter@makholm.net>
Subject: Re: Question about regex (nagios plugin)
Message-Id: <87abdq13ux.fsf@hacking.dk>
Ashish Kumar <xml.devel@gmail.com> writes:
> if($get_cpu_util =~ /^.*\s+(\d+)\s+(\d+)\s+(\d+)\s+(\d+)\s*$/){
> $us=$1;
> $sy=$2;
> $id=$3;
> $wa=$4;
> }
I would do something quite different:
open my $vmstat, '-|', 'vmstat 1 5'
or die;
# discard first line
<$vmstat>;
# next line is field names:
my @fields = split /\s+/, <$vmstat>;
my @result;
while(<$vmstat>) {
my %stats;
@stats{ @fields } = split /\s+/;
push @result, \%stats;
}
//Makholm
------------------------------
Date: Tue, 30 Sep 2008 19:29:31 +1000
From: Martien Verbruggen <mgjv@tradingpost.com.au>
Subject: Re: Question about regex (nagios plugin)
Message-Id: <rhrsbg.3ib.ln@news.heliotrope.home>
On Mon, 29 Sep 2008 23:29:41 -0700 (PDT),
Ashish Kumar <xml.devel@gmail.com> wrote:
> Hello,
>
> I'm developing a plugin for nagios to get CPU usage on Red Hat Linux
> machines. Below is a snippet:
\begin{offtopi}
Why don't you run collectd and use collectd-nagios? That avoids problems
with changes in output of system tools.
\end{offtopic}
Martien
--
|
Martien Verbruggen | For heaven's sake, don't TRY to be cynical.
| It's perfectly easy to be cynical.
|
------------------------------
Date: 6 Apr 2001 21:33:47 GMT (Last modified)
From: Perl-Users-Request@ruby.oce.orst.edu (Perl-Users-Digest Admin)
Subject: Digest Administrivia (Last modified: 6 Apr 01)
Message-Id: <null>
Administrivia:
#The Perl-Users Digest is a retransmission of the USENET newsgroup
#comp.lang.perl.misc. For subscription or unsubscription requests, send
#the single line:
#
# subscribe perl-users
#or:
# unsubscribe perl-users
#
#to almanac@ruby.oce.orst.edu.
NOTE: due to the current flood of worm email banging on ruby, the smtp
server on ruby has been shut off until further notice.
To submit articles to comp.lang.perl.announce, send your article to
clpa@perl.com.
#To request back copies (available for a week or so), send your request
#to almanac@ruby.oce.orst.edu with the command "send perl-users x.y",
#where x is the volume number and y is the issue number.
#For other requests pertaining to the digest, send mail to
#perl-users-request@ruby.oce.orst.edu. Do not waste your time or mine
#sending perl questions to the -request address, I don't have time to
#answer them even if I did know the answer.
------------------------------
End of Perl-Users Digest V11 Issue 1889
***************************************