[30261] in Perl-Users-Digest
Perl-Users Digest, Issue: 1504 Volume: 11
daemon@ATHENA.MIT.EDU (Perl-Users Digest)
Fri May 2 18:09:40 2008
Date: Fri, 2 May 2008 15:09:07 -0700 (PDT)
From: Perl-Users Digest <Perl-Users-Request@ruby.OCE.ORST.EDU>
To: Perl-Users@ruby.OCE.ORST.EDU (Perl-Users Digest)
Perl-Users Digest Fri, 2 May 2008 Volume: 11 Number: 1504
Today's topics:
Re: Devel::SmallProf claims "return 1" needs much time <sfandino@gmail.com>
Re: Devel::SmallProf claims "return 1" needs much time xhoster@gmail.com
Re: Devel::SmallProf claims "return 1" needs much time xhoster@gmail.com
Re: Frequency in large datasets <ced@blv-sam-01.ca.boeing.com>
Re: Help: Reverse Letters <benkasminbullock@gmail.com>
Re: Help: Reverse Letters <jurgenex@hotmail.com>
Re: Help: Reverse Letters <wahab-mail@gmx.de>
Re: Help: Reverse Letters <glennj@ncf.ca>
Re: Help: Reverse Letters <wahab-mail@gmx.de>
Re: Help: Reverse Letters <jurgenex@hotmail.com>
Re: Help: Reverse Letters <jurgenex@hotmail.com>
Re: Read 20 lines when pressing n for next <get@bentsys.com>
Re: Read 20 lines when pressing n for next <simon.chao@fmr.com>
Re: Read 20 lines when pressing n for next <get@bentsys.com>
Re: Read 20 lines when pressing n for next <spamtrap@dot-app.org>
Re: Read 20 lines when pressing n for next <get@bentsys.com>
Re: Stuffing @users into $self->{'users'} <yankeeinexile@gmail.com>
Re: Will Perl 6 be usable as a procedure language? <uri@stemsystems.com>
Digest Administrivia (Last modified: 6 Apr 01) (Perl-Users-Digest Admin)
----------------------------------------------------------------------
Date: Fri, 2 May 2008 13:17:40 -0700 (PDT)
From: salva <sfandino@gmail.com>
Subject: Re: Devel::SmallProf claims "return 1" needs much time !?
Message-Id: <d7c8244c-41ca-489f-b129-1d80d6a38083@27g2000hsf.googlegroups.com>
On Apr 30, 2:51 pm, whumann <w.c.hum...@arcor.de> wrote:
> Much of the time is spent in "seek", "print" and "read" -- as expected
> (although I'm surprised it's only tenths of microseconds per call -- I
> suppose disc caches work their wonders...). But even more time is
> spent in the two "return" statements, and I don't know why! I thought
> that maybe they contain the overhead of function calling/returning but
> coudn't verify that in a simple testscript. Is this an artifact of the
> perl debugger? Or what else is the cause for this?
> Thanks for any help understanding this.
Hi, I am the current maintainer of Devel::SmallProf and I would be
grateful if you could send to me a bug report for that, including the
details about how to exactly reproduce the problem
Cheers,
- Salva
------------------------------
Date: 02 May 2008 20:25:28 GMT
From: xhoster@gmail.com
Subject: Re: Devel::SmallProf claims "return 1" needs much time !?
Message-Id: <20080502162531.321$iw@newsreader.com>
salva <sfandino@gmail.com> wrote:
> On Apr 30, 2:51 pm, whumann <w.c.hum...@arcor.de> wrote:
>
> > Much of the time is spent in "seek", "print" and "read" -- as expected
> > (although I'm surprised it's only tenths of microseconds per call -- I
> > suppose disc caches work their wonders...). But even more time is
> > spent in the two "return" statements, and I don't know why! I thought
> > that maybe they contain the overhead of function calling/returning but
> > coudn't verify that in a simple testscript. Is this an artifact of the
> > perl debugger? Or what else is the cause for this?
> > Thanks for any help understanding this.
>
> Hi, I am the current maintainer of Devel::SmallProf and I would be
> grateful if you could send to me a bug report for that, including the
> details about how to exactly reproduce the problem
>
> Cheers,
Hi Salva,
Here is an example:
$ cat foo.pl
use strict;
use warnings;
use constant foobar =>1;
BEGIN
{
%DB::packages = ( 'package' => 1 );
}
foreach (1..5) {
package::bar();
foo();
};
exit;
sub foo {
sleep 1;
return 1;
};
package package;
sub bar {
sleep 1;
return 1;
};
__END__
All the time spent in the (unmonitored) foo is attributed
to the last statement in (monitored) bar.
0 0.00000 0.00000 16:
5 0.00000 0.00000 17:sub foo {
0 0.00000 0.00000 18: sleep 1;
0 0.00000 0.00000 19: return 1;
0 0.00000 0.00000 20:};
0 0.00000 0.00000 21:
0 0.00000 0.00000 22:package package;
5 0.00000 0.00000 23:sub bar {
5 5.01095 0.00000 24: sleep 1;
5 5.00817 0.00000 25: return 1;
0 0.00000 0.00000 26:};
0 0.00000 0.00000 27:
Posted and mailed.
Cheers,
Xho
--
-------------------- http://NewsReader.Com/ --------------------
The costs of publication of this article were defrayed in part by the
payment of page charges. This article must therefore be hereby marked
advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate
this fact.
------------------------------
Date: 02 May 2008 22:07:53 GMT
From: xhoster@gmail.com
Subject: Re: Devel::SmallProf claims "return 1" needs much time !?
Message-Id: <20080502180756.644$Lx@newsreader.com>
Wolfram Humann <w.c.humann@arcor.de> wrote:
> On 30 Apr., 23:52, xhos...@gmail.com wrote:
> > Wolfram Humann <w.c.hum...@arcor.de> wrote:
> >
> > I'm not sure, but I think that by restricting your packages that way,
> > all the time spent in a non-monitored package will get attributed to
> > the most recently executed statement which is in one of the monitored
> > packages=
> .
> > That statement is likely to be a "return".
>
> I never thought of that but it sounds quite possible. Thanks for the
> hint.
And I've verified that this is indeed the case.
>
> > It looks like DBM::Deep is trying to change from a module to tie hashes
> > to disk with as little differences as possible (behvior-wise) from a
> > regular Perl hash; and instead turn into a full-fledged ACID database.
> > I think that that is unfortunate. Perhaps a code fork is in
> > order.
>
> I rather think that during the major rework to version 1.000 a few
> things got introduced that make the module unnecessary slow. I posted
> here
> http://groups.google.com/group/DBM-Deep/browse_thread/thread/9ae2ae3013=
> 0a49f7 what I think is one major problem. I would appreciate comments if
> you have the time to look into that.
It looks like your proposed change should work, unless $orig_loc or
$old_loc are objects with operator overloading, which doesn't seem to be
the case. (But I do have to wonder why it was done the way it was in the
first place. It is certainly an oddly contorted way of doing things if it
wasn't done like that for a reason.)
Anyway, I ran the self-tests that come with DBM-Deep with your proposed
change in place and it passes all tests, so I'd call it good. And it does
make it much faster, but as you note, it still isn't all that speedy.
Reverting back to DBM version 0.983 is 20 times faster than even your
improved version.
>
> If my profiling results are worth anything, code like "sub engine
> { $_[0]{engine} }" (in Engine.pm) is also a bad idea because it's
> called so often. And then "$e =3D $self->engine" is just two characters
> less than "$e =3D $self->{engine}" and probably much slower. But I still
> need to ask Rob Kinyon if there are any reasons I don't know for these
> subs.
That is classic OO programming to support inheritance. Some subclass might
want to override engine(), which of course it can't do if
"$e = $self->{engine}" is used instead of "$e = $self->engine"
Xho
--
-------------------- http://NewsReader.Com/ --------------------
The costs of publication of this article were defrayed in part by the
payment of page charges. This article must therefore be hereby marked
advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate
this fact.
------------------------------
Date: Fri, 2 May 2008 12:26:48 -0700 (PDT)
From: "comp.llang.perl.moderated" <ced@blv-sam-01.ca.boeing.com>
Subject: Re: Frequency in large datasets
Message-Id: <38458373-ad4f-45c2-b977-fbab4872ae23@p39g2000prm.googlegroups.com>
On May 1, 8:26 pm, Cosmic Cruizer <XXjbhun...@white-star.com> wrote:
> Cosmic Cruizer <XXjbhun...@white-star.com> wrote innews:Xns9A90D0E1FD16ccruizermydejacom@207.115.17.102:
>
>
>
>
>
> > Gunnar Hjalmarsson <nore...@gunnar.cc> wrote in
> >news:67so01F2nertiU1@mid.individual.net:
>
> >> Cosmic Cruizer wrote:
> >>> I've been able to reduce my dataset by 75%, but it still leaves me
> >>> with a file of 47 gigs. I'm trying to find the frequency of each line
> >>> using:
>
> >>> open(TEMP, "< $tempfile") || die "cannot open file
> >>> $tempfile:
> >>> $!";
> >>> foreach (<TEMP>) {
> >>> $seen{$_}++;
> >>> }
> >>> close(TEMP) || die "cannot close file
> >>> $tempfile: $!";
>
> >>> My program keeps aborting after a few minutes because the computer
> >>> runs out of memory.
>
> >> This line:
>
> >>> foreach (<TEMP>) {
>
> >> reads the whole file into memory. You should read the file line by
> >> line instead by replacing it with:
>
> >> while (<TEMP>) {
>
> ><sigh> As both you and Sinan pointed out... I'm using foreach.
> Everywhere
> > else I used the while statement to get me to this point. This solves
> the
> > problem.
>
> > Thank you.
>
> Well... that did not make any difference at all. I still get up to about
> 90% of the physical ram and the job aborts within about the same
> timeframe. From what I can tell, using while did not make any difference
> than using foreach. I tried using the two swapfiles idea, but that is not
> a viable solution. I guess the only thing to do is to break the files
> down into smaller chunks of about 5 gigs each. That will give me about 3
> to 4 days worth of data at a time. After that, I can look at what I have
> and decide how I can optimize the data for the next run.
While slower, you could use a DBM if %seen is
overgrowing memory, eg,
my $db = tie %seen, 'DB_File', [$filename, $flags, $mode, $DB_HASH]
or die ...
--
Charles DeRykus
------------------------------
Date: Fri, 2 May 2008 15:09:25 +0000 (UTC)
From: Ben Bullock <benkasminbullock@gmail.com>
Subject: Re: Help: Reverse Letters
Message-Id: <fvfar5$j1i$1@ml.accsnet.ne.jp>
On Fri, 02 May 2008 22:53:08 +0800, Amy Lee wrote:
> reverse $_;
"Useless use of reverse in void context at ./usenet-2May2008-2.pl line 8."
As A. Sinan Unur told you previously, you should always
use warnings;
use strict;
------------------------------
Date: Fri, 02 May 2008 15:15:32 GMT
From: Jürgen Exner <jurgenex@hotmail.com>
Subject: Re: Help: Reverse Letters
Message-Id: <6rbm145vn9maor3gd1qlqjvvbib6ik21bv@4ax.com>
Amy Lee <openlinuxsource@gmail.com> wrote:
>> Amy Lee <openlinuxsource@gmail.com> wrote:
>>>There's a problem while I'm processing sequences. My file content.
>>>ATGCCCTGACGTAAACGTAGGCTACG
>>>And I hope I can reverse the sequences to be this.
>>>GCATCGGATGCAAATGCAGTCCCGTA
>>
>> You asked a self answering question: The reverse() function does exactly
>> that.
>>
>>>I use "reverse" to do this, but it dose not work any more.
>>
>> ?????
>> Are you saying that coming back into the office after yesterday's Labour
>> Day the functionality of reverse() in Perl has changed?
> unless (/^>.*$/)
> {
> reverse $_;
> }
Had you used
use warnings; use strict;
as it strongly recommended then perl itself would have told you:
"Useless use of reverse in void context at [...] line [...]."
In other words: You reverse the content of $_ and then throw it away.
jue
------------------------------
Date: Fri, 02 May 2008 17:04:27 +0200
From: Mirco Wahab <wahab-mail@gmx.de>
Subject: Re: Help: Reverse Letters
Message-Id: <fvfbt8$6gf$1@mlucom4.urz.uni-halle.de>
Amy Lee wrote:
> while (<$FILE_IN>)
> {
> unless (/^>.*$/)
> {
> reverse $_;
You need to reverse the order of the reverse
operator, before reversing the text:
$_ =reverse;
Regards
M.
------------------------------
Date: 2 May 2008 15:51:34 GMT
From: Glenn Jackman <glennj@ncf.ca>
Subject: Re: Help: Reverse Letters
Message-Id: <slrng1me47.2u1.glennj@smeagol.ncf.ca>
At 2008-05-02 11:04AM, "Mirco Wahab" wrote:
> Amy Lee wrote:
> > while (<$FILE_IN>)
> > {
> > unless (/^>.*$/)
> > {
> > reverse $_;
>
> You need to reverse the order of the reverse
> operator, before reversing the text:
>
> $_ =reverse;
Also, the newline character will be reversed, so that should be removed
first:
while (<$FILE_IN>) {
chomp;
$_ = reverse unless /^>/;
print "$_\n";
}
--
Glenn Jackman
"If there is anything the nonconformist hates worse than a conformist,
it's another nonconformist who doesn't conform to the prevailing
standard of nonconformity." -- Bill Vaughan
------------------------------
Date: Fri, 02 May 2008 18:21:15 +0200
From: Mirco Wahab <wahab-mail@gmx.de>
Subject: Re: Help: Reverse Letters
Message-Id: <fvffha$7hh$1@mlucom4.urz.uni-halle.de>
Amy Lee wrote:
> Thank you very much. However, I still have a problem which I can't
> understand well. What if my file content is
>> seq1
> ACGGTC
> ACTG
>> seq2
> CGATCC
> ACCTC
> In fact, the sequence is
>> seq1
> ACGGTCACTG
>> seq2
> CGATCCACCTC
>
> So if I use the above codes to do that, I can't acquire the correct
> sequences. I hope I can process the file that I mention.
Then you have to extract the sequences between
some bounds marker according to your problem.
You coult read the file w/different record
separator (eg. "\nseq") or create a regular
expression to extractz the sequences from
the file slurped into a buffer, like:
...
use warnings;
use strict;
# read the file into a buffer ($seq)
open my $fh, '<', 'sequence.dat' or die $!;
my $seq; do { local $/; $seq = <$fh> };
close $fh;
# extract sequence records
my $match = qr{>[^\n\r]+([^>]+|$)}s;
while($seq =~ /$match/g) {
(my $sequence = $1) =~ tr/\n\r//d;
print "'$sequence'=>" . reverse($sequence) . "\n"
}
...
Regards
M.
------------------------------
Date: Fri, 02 May 2008 16:58:58 GMT
From: Jürgen Exner <jurgenex@hotmail.com>
Subject: Re: Help: Reverse Letters
Message-Id: <erhm14tp19atpej15rk90eoitvade1qtg1@4ax.com>
Amy Lee <openlinuxsource@gmail.com> wrote:
[reversing strings]
>What if my file content is
>>seq1
>ACGGTC
>ACTG
>>seq2
>CGATCC
>ACCTC
>In fact, the sequence is
>>seq1
>ACGGTCACTG
>>seq2
>CGATCCACCTC
You have a gift of stating requirements in a complex way that is
ambigious at best.
Are you saying that your data is split among many lines and should be
reversed across the whole file instead of line by line?
If that is the case then just slurp in the whole file into a single
string and reverse that string. Depending on if you want to preserve the
line breaks you may either have to chomp()/remove them or adjust the
leading/trailing line break of the whole file.
jue
------------------------------
Date: Fri, 02 May 2008 21:57:43 GMT
From: Jürgen Exner <jurgenex@hotmail.com>
Subject: Re: Help: Reverse Letters
Message-Id: <ag3n14lr64a6hb6s02n2va2pddd2b4l5m0@4ax.com>
Jürgen Exner <jurgenex@hotmail.com> wrote:
>Are you saying that your data is split among many lines and should be
>reversed across the whole file instead of line by line?
>
>If that is the case then just slurp in the whole file into a single
>string and reverse that string. Depending on if you want to preserve the
>line breaks you may either have to chomp()/remove them or adjust the
>leading/trailing line break of the whole file.
Oh, or of course you could just slurp the whole file into an array and
run reverse() twice, once on the array and once on each element of the
array. Details see the man page for reverse().
jue
------------------------------
Date: Fri, 2 May 2008 09:34:20 -0700
From: "Gordon Etly" <get@bentsys.com>
Subject: Re: Read 20 lines when pressing n for next
Message-Id: <680u4dF2qsgdmU1@mid.individual.net>
Keith Keller wrote:
> On 2008-05-02, Uri Guttman <uri@stemsystems.com> wrote:
> > Gordon Etly <get@bentsys.com> writes:
> >
> > > It could be homework, just as it could be any number of things.
> > > Could just be how the OP put together his post, listing what he
> > > wanted to do. The point is _you_ _don't_ _know_.
>
> Are you going to help, or are you going to continue to troll?
Translation: one cannot have an opinion or make a point that conflicts
with your own, lest the world cometh tumbling down to the ground. For
shame.
> > and you know it is the opposite? how nice of you to tell us.
"I don't know either way, but neither do you. That's the point."
-from my other reply.
It's a point that you and Uri do not like, but last I checked, a
disagreement doesn't
> Seriously--since ''Gordon'' isn't posting *wrong* Perl, there's no
> reason to continue to reply to him. Perhaps if we all ignore him
> he'll either stop posting his ridiculous rants, or he'll post actual
> help.
I am a helping on several lists. If I could help in every single list I
have interest in, I would have to spend every waking moment going form
list to list, which isn't very realistic. Perhaps I'll spend more time
here when I tire of one of the ones I do offer help in. Either way, it's
not, and never has been, a requirement for posting comments in a group,
list, forum, or other.
--
G.Etly
------------------------------
Date: Fri, 2 May 2008 10:22:46 -0700 (PDT)
From: nolo contendere <simon.chao@fmr.com>
Subject: Re: Read 20 lines when pressing n for next
Message-Id: <ee6e47db-14df-442b-babf-cf1d176717ee@b1g2000hsg.googlegroups.com>
On May 2, 12:34=A0pm, "Gordon Etly" <g...@bentsys.com> wrote:
> Keith Keller wrote:
> > On 2008-05-02, Uri Guttman <u...@stemsystems.com> wrote:
> > > Gordon Etly <g...@bentsys.com> writes:
>
> > > > It could be homework, just as it could be any number of things.
> > > > Could just be how the OP put together his post, listing what he
> > > > wanted to do. The point is _you_ _don't_ _know_.
>
> > Are you going to help, or are you going to continue to troll?
>
> Translation: one cannot have an opinion or make a point that conflicts
> with your own, lest the world cometh tumbling down to the ground. For
> shame.
I wouldn't translate Keith's statement that way. Rather, I'd say that
he is implying that you're being needlessly argumentative, and that
your line of discussion is not productive.
------------------------------
Date: Fri, 2 May 2008 11:06:37 -0700
From: "Gordon Etly" <get@bentsys.com>
Subject: Re: Read 20 lines when pressing n for next
Message-Id: <6813hfF2q4nvoU1@mid.individual.net>
nolo contendere wrote:
> On May 2, 12:34 pm, "Gordon Etly" <g...@bentsys.com> wrote:
> > Keith Keller wrote:
> > > On 2008-05-02, Uri Guttman <u...@stemsystems.com> wrote:
> > > > Gordon Etly <g...@bentsys.com> writes:
> >
> > > > > It could be homework, just as it could be any number of
> > > > > things.
> > > > > Could just be how the OP put together his post, listing what
> > > > > he
> > > > > wanted to do. The point is _you_ _don't_ _know_.
> >
> > > Are you going to help, or are you going to continue to troll?
> >
> > Translation: one cannot have an opinion or make a point that
> > conflicts with your own, lest the world cometh tumbling down to the
> > ground. For shame.
>
> I wouldn't translate Keith's statement that way. Rather, I'd say that
> he is implying that you're being needlessly argumentative, and that
> your line of discussion is not productive.
Well, it might not be the most productive, but it no less than Uri and
others making such assumptions that could easily be wrong. Frankly,
since when can one not comment on what someone else wrote? As I recall,
that by posting in a public forum, you are inviting comments, and that's
all I'm doing, yet some people choose to get on the defensive and sling
mud, rather than engage in a civil discussion.
--
G.Etly
------------------------------
Date: Fri, 02 May 2008 16:31:06 -0400
From: Sherman Pendley <spamtrap@dot-app.org>
Subject: Re: Read 20 lines when pressing n for next
Message-Id: <m1ej8k5tyt.fsf@dot-app.org>
"Gordon Etly" <get@bentsys.com> writes:
> Well, it might not be the most productive, but it no less than Uri and
> others making such assumptions that could easily be wrong.
Spare me. Seriously - spare me.
Another with two brain cells can see that the OP's question was homework.
This has nothing to do with that. You've just got your panties in a knot
about the whole stupid "PERL vs Perl" thread, and you're whining about
every damn thing Uri says.
Grow up and give it a rest already. I'm sick of seeing your "Uri is evil"
spew in every damn thread. We get it, you don't like Uri - STFU about it.
sherm--
--
My blog: http://shermspace.blogspot.com
Cocoa programming in Perl: http://camelbones.sourceforge.net
------------------------------
Date: Fri, 2 May 2008 15:02:51 -0700
From: "Gordon Etly" <get@bentsys.com>
Subject: Re: Read 20 lines when pressing n for next
Message-Id: <681hccF2quds4U1@mid.individual.net>
Sherman Pendley wrote:
> "Gordon Etly" <get@bentsys.com> writes:
>
> > Well, it might not be the most productive, but it no less than Uri
> > and others making such assumptions that could easily be wrong.
>
> Spare me. Seriously - spare me.
Oh, sorry to have infringed on his royal majesty.
> Another with two brain cells can see that the OP's question was
> homework.
You don't know that, which was the point I made and you just happily
skipped over.
> This has nothing to do with that. You've just got your
> panties in a knot about the whole stupid "PERL vs Perl" thread, and
Heh. It seemed it was people like your self that had their underware
wound up in quite a bunch...
> you're whining about every damn thing Uri says.
... I made a point and people like Uri decided use cheap technicalities,
as well as to attack my character rather than submit a real refute to my
core point.
> Grow up and give it a rest already. I'm sick of seeing your "Uri is
> evil"
I dare you to point out where I actually said that. It seems to me
people like you and Uri simply cannot stand to have such faults pointed
out, for if one does it's time to whip out the ol' pitch forks and
torches...
And I'm the one who has to grow up... thanks you made my day with that
one :)
--
G.Etly
------------------------------
Date: 02 May 2008 10:41:46 -0500
From: Lawrence Statton <yankeeinexile@gmail.com>
Subject: Re: Stuffing @users into $self->{'users'}
Message-Id: <87wsmcn26d.fsf@hummer.cluon.com>
"szr" <szrRE@szromanMO.comVE> writes:
>
> Maybe a better analogy would be putting tape over the warning lights
> (check engine, ...) in your car.
>
That reminds me, I need to buy more tape.
--
Lawrence Statton - lawrenabae@abaluon.abaom s/aba/c/g
Computer software consists of only two components: ones and
zeros, in roughly equal proportions. All that is required is to
place them into the correct order.
------------------------------
Date: Fri, 02 May 2008 15:22:51 GMT
From: Uri Guttman <uri@stemsystems.com>
Subject: Re: Will Perl 6 be usable as a procedure language?
Message-Id: <x7r6ckohmd.fsf@mail.sysarch.com>
>>>>> "BB" == Ben Bullock <benkasminbullock@gmail.com> writes:
BB> Uri Guttman <uri@stemsystems.com> wrote:
>> the albatross of true backwards compatibility is what has
>> kept x86 and redmond so 'backwards' for decades.
BB> But backwards-compatibility-albatross-less Perl 6 has been under
BB> development for eight years, which is getting on for one decade.
if any of you would actually follow the perl6 lists you would understand
why it is slow going. also there is no corporate or financial backing
and it is all volunteer work. it is a complex but very powerful lang and
its design (and implementation which is separate from parrot) is not a
trival thing. i prefer to let it gestate at its own rate and be
patient. no one expects it out by christmas and no one claims otherwise.
uri
--
Uri Guttman ------ uri@stemsystems.com -------- http://www.sysarch.com --
----- Perl Code Review , Architecture, Development, Training, Support ------
--------- Free Perl Training --- http://perlhunter.com/college.html ---------
--------- Gourmet Hot Cocoa Mix ---- http://bestfriendscocoa.com ---------
------------------------------
Date: 6 Apr 2001 21:33:47 GMT (Last modified)
From: Perl-Users-Request@ruby.oce.orst.edu (Perl-Users-Digest Admin)
Subject: Digest Administrivia (Last modified: 6 Apr 01)
Message-Id: <null>
Administrivia:
#The Perl-Users Digest is a retransmission of the USENET newsgroup
#comp.lang.perl.misc. For subscription or unsubscription requests, send
#the single line:
#
# subscribe perl-users
#or:
# unsubscribe perl-users
#
#to almanac@ruby.oce.orst.edu.
NOTE: due to the current flood of worm email banging on ruby, the smtp
server on ruby has been shut off until further notice.
To submit articles to comp.lang.perl.announce, send your article to
clpa@perl.com.
#To request back copies (available for a week or so), send your request
#to almanac@ruby.oce.orst.edu with the command "send perl-users x.y",
#where x is the volume number and y is the issue number.
#For other requests pertaining to the digest, send mail to
#perl-users-request@ruby.oce.orst.edu. Do not waste your time or mine
#sending perl questions to the -request address, I don't have time to
#answer them even if I did know the answer.
------------------------------
End of Perl-Users Digest V11 Issue 1504
***************************************
