[26014] in Perl-Users-Digest
Perl-Users Digest, Issue: 8230 Volume: 10
daemon@ATHENA.MIT.EDU (Perl-Users Digest)
Fri Jul 8 16:20:52 2005
Date: Wed, 6 Jul 2005 06:05:08 -0700 (PDT)
From: Perl-Users Digest <Perl-Users-Request@ruby.OCE.ORST.EDU>
To: Perl-Users@ruby.OCE.ORST.EDU (Perl-Users Digest)
Perl-Users Digest Wed, 6 Jul 2005 Volume: 10 Number: 8230
Today's topics:
Re: DBD::Sybase / DBD::ODBC + FreeTDS woes - placeholde <am@*t.com.au>
Re: Help With Pattern Matching <tadmc@augustmail.com>
How to take acton upon a pattern of nth occurrence? <a@cuhk.edu.hk>
Re: How to take acton upon a pattern of nth occurrence? <noreply@gunnar.cc>
Re: How to take acton upon a pattern of nth occurrence? <a@cuhk.edu.hk>
Re: How to take acton upon a pattern of nth occurrence? <noreply@gunnar.cc>
Re: How to take acton upon a pattern of nth occurrence? <1usa@llenroc.ude.invalid>
Re: How to take acton upon a pattern of nth occurrence? <programmer16@earthlink.net>
Re: making alternation clearer in regular expressions <joe@example.com>
Re: OT: keeping track of time when programming (aka ? the Platypus)
What is a dependency? - Installation problem (Paul J Mooney)
What is a dependency? - Installation problem (Paul J Mooney)
What is a dependency? - Installation problem (Paul J Mooney)
What is a dependency? - Installation problem (Paul J Mooney)
Re: What is a dependency? - Installation problem <noreply@gunnar.cc>
Re: What is a dependency? - Installation problem <sisyphus1@nomail.afraid.org>
Digest Administrivia (Last modified: 6 Apr 01) (Perl-Users-Digest Admin)
----------------------------------------------------------------------
Date: Wed, 06 Jul 2005 18:04:49 +1000
From: Anthony Mandic <am@*t.com.au>
Subject: Re: DBD::Sybase / DBD::ODBC + FreeTDS woes - placeholders and implicit datatype conversions
Message-Id: <dag3cp$pn0$1@lust.ihug.co.nz>
Richard Gration wrote:
>
> > That may well be, but its also all of ASE. What about just what's
> > needed to get Open Client working? Have you tried copying it over
> > to see?
>
> I haven't, for a couple of reasons: One, I didn't think it stood a cat in
> hell's chance of working and two,
There's only one way to find out.
> it falls into the "hack" category and
> makes migration of code from the dev environment to the live environment
> difficult and also upgrades etc.
Well, have you looked at the commercial alternatives then? Like
Open link for example http://www.openlinksw.com/
> > OK. I'm not sure what it thinks is going on. As far as I know,
> > ASE's parser should know to turn the string "75" into a numeric
> > value. You could try a convert statement to see what it does.
> > What about assigning the "75" to a variable in Perl and passing
> > that in the string?
>
> I have tried that, with identical results. I've also tried convert, and
> that works, but I have a 25,000 line application with 100s of queries
> already written, which work with ct-lib, so converting them all is out of
> the question.
Well, my last suggest would be to fashion the string outside of
the function call. That would mean massive conversion of your
code as well, so its probably not on the cards either.
> I would rather re-install OSes than do that!
You've never installed Windows NT, have you? :-)
> > I'm sure Michael Peppler could offer some advice too.
>
> I sure ... in fact I was hoping he would!
You could always try a private email. He might be on holidays
though.
-am © 2005
------------------------------
Date: Tue, 5 Jul 2005 22:53:06 -0500
From: Tad McClellan <tadmc@augustmail.com>
Subject: Re: Help With Pattern Matching
Message-Id: <slrndcmld2.a89.tadmc@magna.augustmail.com>
Brandon <programmer16@earthlink.net> wrote:
> Try this?
A: No.
> chomp;
> print "$_\n" if m/p/i;
Why take the newline off on one line only to put it back
on the very next line?
[snip TOFU]
--
Tad McClellan SGML consulting
tadmc@augustmail.com Perl programming
Fort Worth, Texas
------------------------------
Date: Wed, 6 Jul 2005 14:01:30 +0800
From: "Ross" <a@cuhk.edu.hk>
Subject: How to take acton upon a pattern of nth occurrence?
Message-Id: <dafs3h$b2l$1@justice.itsc.cuhk.edu.hk>
Dear all,
For the sequence below (indeed a single line), when i use the conditional
checking
if ($line =~ /(.*)A{10,}(.*)/ ) {
$tmpline = $1;
}
to try to remove substring after 10 or more consecutive A's, perl seems to
recognize the last poly A's and leave the former ones intact. what can i do?
In general, How to take acton upon a pattern of nth occurrence?
TCCTCAGTGGGAATTCGGCATTACGGCCGGGGCACCACAATGAATGATCATTTTC
TTCTTTGCTCTCCTTGCTATTGCTGCATGCAGCGCCTCTGCGCAGTTTGATGCTG
TTACTCAAGTTTACAGGCAATATCAGCTGCAGCCGCATCTCATGCTGCAGCAACA
GATGCTTAGCCCATGCGGTGAGTTCGTAAGGCAGCAGTGCAGCACAGTGGCAACC
CCCTTCTTCCAATCACCCGTGTTTCAACTGAGAAACTGCCAAGTCATGCAGCAGC
AGTGCTGCCAACAGCTCAGGATGATCGCGCAACAGTCTCACCGCCAGGCCATTAG
TAGTGTTCAGGCGATTGTGCAGCAGCTACAGCTACAACAGTTTGCTGGCGTCTAC
TTCGATCAGACTCAAGCTCAAGCCCAAGCTATGTTGGCCCTAAACTTGCTGTCAA
TATGCGGTATCTACCCAAGCTACAACACTGCTCCCTGTAGCATTCCCACCGTCGG
TGGTATCTGGTACTGAATTGTAGCAGTATAGTAGTACAGGAGAGAAAAATAAAGT
CATGCATCATCGTGTGTGACAAGTTGAAACATCGGGGTGATACAAATCTGAATAA
AAATGTCATGCAAGTTTAAACANNNNANANNNANNNNAAANAAAAAAAAAAAAAA
AAAANANAAAAAAAAAAAAAAAAAAAAAAAAAAANAAAAANAAAAAAAAAAAAAA
AAAAANNNNNNANANNNNNNAAAAAAAAAAAAAAAAANNNNNNNNNNGGGGGGGG
GGGGGGGCGGGAAGAAAAAAAAAAA
------------------------------
Date: Wed, 06 Jul 2005 08:26:39 +0200
From: Gunnar Hjalmarsson <noreply@gunnar.cc>
Subject: Re: How to take acton upon a pattern of nth occurrence?
Message-Id: <3j1bt3Fn4hejU1@individual.net>
Ross wrote:
> For the sequence below (indeed a single line), when i use the conditional
> checking
>
> if ($line =~ /(.*)A{10,}(.*)/ ) {
------------------------^-^^^^
Why the comma?
Why do you have Perl capture the part you are not interested in?
> $tmpline = $1;
> }
>
> to try to remove substring after 10 or more consecutive A's, perl seems to
> recognize the last poly A's and leave the former ones intact. what can i do?
Did you try making .* non-greedy?
/(.*?A{10})/
(including A{10} in the capturing parenteses matches your description).
Please read about greediness in "perldoc perlre".
> In general, How to take acton upon a pattern of nth occurrence?
Specifically, what is a "pattern of nth occurrence"?
--
Gunnar Hjalmarsson
Email: http://www.gunnar.cc/cgi-bin/contact.pl
------------------------------
Date: Wed, 6 Jul 2005 17:33:30 +0800
From: "Ross" <a@cuhk.edu.hk>
Subject: Re: How to take acton upon a pattern of nth occurrence?
Message-Id: <dag8h1$dfv$1@justice.itsc.cuhk.edu.hk>
"Gunnar Hjalmarsson" <noreply@gunnar.cc> wrote in message
news:3j1bt3Fn4hejU1@individual.net...
> Ross wrote:
>> For the sequence below (indeed a single line), when i use the conditional
>> checking
>>
>> if ($line =~ /(.*)A{10,}(.*)/ ) {
> ------------------------^-^^^^
> Why the comma?
> Why do you have Perl capture the part you are not interested in?
>
>> $tmpline = $1;
>> }
>>
>> to try to remove substring after 10 or more consecutive A's, perl seems
>> to recognize the last poly A's and leave the former ones intact. what can
>> i do?
>
> Did you try making .* non-greedy?
>
> /(.*?A{10})/
>
> (including A{10} in the capturing parenteses matches your description).
>
> Please read about greediness in "perldoc perlre".
>
>> In general, How to take acton upon a pattern of nth occurrence?
>
> Specifically, what is a "pattern of nth occurrence"?
Dear Gunnar Hjalmarsson,
I am a beginner. From a Perl bible, {10,} means minimum number and without
maximum. What i'm trying to specify the pattern is to find out, the 1st
occurrence of poly A's (number equal to or more than 10) and then only
retain the substring in front of it. To generalize, i wonder if there is
convenient built-in syntax to test for nth occurrence (indeed, i know a loop
may do the task). the .*, according to the bible, just represents a
substring of any pattern only. Thanks for your response.
--Ross
------------------------------
Date: Wed, 06 Jul 2005 13:34:48 +0200
From: Gunnar Hjalmarsson <noreply@gunnar.cc>
Subject: Re: How to take acton upon a pattern of nth occurrence?
Message-Id: <3j1turFnr353U1@individual.net>
Ross wrote:
> Gunnar Hjalmarsson wrote:
>> Ross wrote:
>>> For the sequence below (indeed a single line), when i use the conditional
>>> checking
>>>
>>> if ($line =~ /(.*)A{10,}(.*)/ ) {
>> -----------------------^-^^^^
>> Why the comma?
>> Why do you have Perl capture the part you are not interested in?
>>
>>> $tmpline = $1;
>>> }
>>>
>>> to try to remove substring after 10 or more consecutive A's, perl seems
>>> to recognize the last poly A's and leave the former ones intact. what can
>>> i do?
>>
>> Did you try making .* non-greedy?
>>
>> /(.*?A{10})/
>>
>> (including A{10} in the capturing parenteses matches your description).
>>
>> Please read about greediness in "perldoc perlre".
>>
>>> In general, How to take acton upon a pattern of nth occurrence?
>>
>> Specifically, what is a "pattern of nth occurrence"?
>
> From a Perl bible, {10,} means minimum number and without
> maximum.
I agree that {10,} means minimum, but {10} means exactly 10, not maximum
( which would have been written {0,10} ). If your "bible" says something
else, please drop it and use the Perl documentation instead.
The reason I asked about the comma, i.e. matching at least 10, is that
it seems to be unnecessary considering what you are trying to do. But
it's not wrong. Just trying to avoid a redundant character. ;-)
> What i'm trying to specify the pattern is to find out, the 1st
> occurrence of poly A's (number equal to or more than 10) and then only
> retain the substring in front of it.
That differs slightly from how you explained it in your original post,
so I'd better change my suggested regex to
/(.*?)A{10}/
Did you try it?
Did you read about greediness in "perldoc perlre"?
> To generalize, i wonder if there is
> convenient built-in syntax to test for nth occurrence
And I still don't understand the meaning of "nth occurrence".
> the .*, according to the bible, just represents a
> substring of any pattern
Not newline by default, according to the Perl documentation.
Greediness, greediness...
--
Gunnar Hjalmarsson
Email: http://www.gunnar.cc/cgi-bin/contact.pl
------------------------------
Date: Wed, 06 Jul 2005 12:29:31 GMT
From: "A. Sinan Unur" <1usa@llenroc.ude.invalid>
Subject: Re: How to take acton upon a pattern of nth occurrence?
Message-Id: <Xns968B56636243Easu1cornelledu@127.0.0.1>
"Ross" <a@cuhk.edu.hk> wrote in
news:dafs3h$b2l$1@justice.itsc.cuhk.edu.hk:
> Dear all,
> For the sequence below (indeed a single line), when i use the
> conditional
> checking
>
> if ($line =~ /(.*)A{10,}(.*)/ ) {
> $tmpline = $1;
> }
>
> to try to remove substring after 10 or more consecutive A's, perl
> seems to recognize the last poly A's and leave the former ones intact.
> what can i do? In general, How to take acton upon a pattern of nth
> occurrence?
It seems to me that you should be using index rather than regular
expressions, although I am not sure what you mean by "nth occurence".
If I understand you correctly, you want to find the first string of at
least 10 As, and only keep the substring up to and including the last
character before that string of at least 10 As. That can be translated
directly to Perl in a very straightforward way:
#!/usr/bin/perl
use strict;
use warnings;
my $s;
while( <DATA> ) {
chomp;
$s .= $_;
}
my $r = substr $s, 0, index $s, 'AAAAAAAAAA';
print "$r\n";
__END__
TCCTCAGTGGGAATTCGGCATTACGGCCGGGGCACCACAATGAATGATCATTTTC
TTCTTTGCTCTCCTTGCTATTGCTGCATGCAGCGCCTCTGCGCAGTTTGATGCTG
TTACTCAAGTTTACAGGCAATATCAGCTGCAGCCGCATCTCATGCTGCAGCAACA
GATGCTTAGCCCATGCGGTGAGTTCGTAAGGCAGCAGTGCAGCACAGTGGCAACC
CCCTTCTTCCAATCACCCGTGTTTCAACTGAGAAACTGCCAAGTCATGCAGCAGC
AGTGCTGCCAACAGCTCAGGATGATCGCGCAACAGTCTCACCGCCAGGCCATTAG
TAGTGTTCAGGCGATTGTGCAGCAGCTACAGCTACAACAGTTTGCTGGCGTCTAC
TTCGATCAGACTCAAGCTCAAGCCCAAGCTATGTTGGCCCTAAACTTGCTGTCAA
TATGCGGTATCTACCCAAGCTACAACACTGCTCCCTGTAGCATTCCCACCGTCGG
TGGTATCTGGTACTGAATTGTAGCAGTATAGTAGTACAGGAGAGAAAAATAAAGT
CATGCATCATCGTGTGTGACAAGTTGAAACATCGGGGTGATACAAATCTGAATAA
AAATGTCATGCAAGTTTAAACANNNNANANNNANNNNAAANAAAAAAAAAAAAAA
AAAANANAAAAAAAAAAAAAAAAAAAAAAAAAAANAAAAANAAAAAAAAAAAAAA
AAAAANNNNNNANANNNNNNAAAAAAAAAAAAAAAAANNNNNNNNNNGGGGGGGG
GGGGGGGCGGGAAGAAAAAAAAAAA
--
A. Sinan Unur <1usa@llenroc.ude.invalid>
(reverse each component and remove .invalid for email address)
comp.lang.perl.misc guidelines on the WWW:
http://mail.augustmail.com/~tadmc/clpmisc/clpmisc_guidelines.html
------------------------------
Date: Wed, 06 Jul 2005 12:51:10 GMT
From: "Brandon" <programmer16@earthlink.net>
Subject: Re: How to take acton upon a pattern of nth occurrence?
Message-Id: <2tQye.5304$aY6.3119@newsread1.news.atl.earthlink.net>
Try adding ? to the first .* to make (.*?). The * modifier takes up as much
as it can without turning false, so it'll match the last 10 consecutive A's,
not the first.
"Ross" <a@cuhk.edu.hk> wrote in message
news:dafs3h$b2l$1@justice.itsc.cuhk.edu.hk...
> Dear all,
> For the sequence below (indeed a single line), when i use the conditional
> checking
>
> if ($line =~ /(.*)A{10,}(.*)/ ) {
> $tmpline = $1;
> }
>
> to try to remove substring after 10 or more consecutive A's, perl seems to
> recognize the last poly A's and leave the former ones intact. what can i
> do? In general, How to take acton upon a pattern of nth occurrence?
>
> TCCTCAGTGGGAATTCGGCATTACGGCCGGGGCACCACAATGAATGATCATTTTC
> TTCTTTGCTCTCCTTGCTATTGCTGCATGCAGCGCCTCTGCGCAGTTTGATGCTG
> TTACTCAAGTTTACAGGCAATATCAGCTGCAGCCGCATCTCATGCTGCAGCAACA
> GATGCTTAGCCCATGCGGTGAGTTCGTAAGGCAGCAGTGCAGCACAGTGGCAACC
> CCCTTCTTCCAATCACCCGTGTTTCAACTGAGAAACTGCCAAGTCATGCAGCAGC
> AGTGCTGCCAACAGCTCAGGATGATCGCGCAACAGTCTCACCGCCAGGCCATTAG
> TAGTGTTCAGGCGATTGTGCAGCAGCTACAGCTACAACAGTTTGCTGGCGTCTAC
> TTCGATCAGACTCAAGCTCAAGCCCAAGCTATGTTGGCCCTAAACTTGCTGTCAA
> TATGCGGTATCTACCCAAGCTACAACACTGCTCCCTGTAGCATTCCCACCGTCGG
> TGGTATCTGGTACTGAATTGTAGCAGTATAGTAGTACAGGAGAGAAAAATAAAGT
> CATGCATCATCGTGTGTGACAAGTTGAAACATCGGGGTGATACAAATCTGAATAA
> AAATGTCATGCAAGTTTAAACANNNNANANNNANNNNAAANAAAAAAAAAAAAAA
> AAAANANAAAAAAAAAAAAAAAAAAAAAAAAAAANAAAAANAAAAAAAAAAAAAA
> AAAAANNNNNNANANNNNNNAAAAAAAAAAAAAAAAANNNNNNNNNNGGGGGGGG
> GGGGGGGCGGGAAGAAAAAAAAAAA
>
>
>
------------------------------
Date: Tue, 05 Jul 2005 21:36:32 -0400
From: joe <joe@example.com>
Subject: Re: making alternation clearer in regular expressions
Message-Id: <mdOdnWtfheaWqlbfRVn-vQ@rcn.net>
Tad McClellan wrote:
> joe <joe@example.com> wrote:
>
>
>
>>Ugh... Nevermind. Brain malfunction. Something was causing me to
>>(subconsciously) treat the beginning and end of string characters
>
>
>
> There is no such thing as "end of string characters".
For the love of God, I was obviously referring to the characters that
_REPRESENT_ the beginning and ends of a string in a Perl regular
expression. Those most certainly *are* characters.
> Anchors are "zero width", they match _positions_ in a string,
> not characters in a string.
Irrelevant. Did you see a caret or dollar sign in my example pattern?
There was no ambiguity. Besides, "assertion" is Perlier diction.
-J
------------------------------
Date: Wed, 06 Jul 2005 03:54:30 GMT
From: "David Formosa (aka ? the Platypus)" <dformosa@dformosa.zeta.org.au>
Subject: Re: OT: keeping track of time when programming
Message-Id: <slrndcmkp6.li.dformosa@dformosa.zeta.org.au>
On Mon, 04 Jul 2005 20:39:08 -0400, Dave <dave@nospam.com> wrote:
><frustrated>
>
> Sorry, this mostly doesn't belong here, but I just became very
> frustrated when I looked at the clock and noticed yet again that hours
> had passed in what seemed like minutes!
Its called a coder trance, or in more general terms its a flow state.
--
Please excuse my spelling as I suffer from agraphia. See
http://dformosa.zeta.org.au/~dformosa/Spelling.html to find out more.
Free the Memes.
------------------------------
Date: Wed, 06 Jul 2005 06:17:33 GMT
From: pjmooney@panix.com (Paul J Mooney)
Subject: What is a dependency? - Installation problem
Message-Id: <1105_1120630653@pm1-13.dynamic.access.net>
What, in Perl, is a dependency? The
reason that I'm asking is that I've
been trying to install Perl (Version
5.8.6) on a DOS/DJGPP platform,
but I can't get the dependencies to
compile with Make. After running
Configure, I've tried to run "Make
Depend", but I keep getting this error
message: " *** No rule to make target
`depend'. Stop.".
------------------------------
Date: Wed, 06 Jul 2005 06:20:23 GMT
From: pjmooney@panix.com (Paul J Mooney)
Subject: What is a dependency? - Installation problem
Message-Id: <1106_1120630823@pm1-13.dynamic.access.net>
What, in Perl, is a dependency? The reason that I'm asking
is that I've been trying to install Perl (Version 5.8.6) on a
DOS/DJGPP platform,
but I can't get the dependencies to compile with Make.
After running Configure, I've tried to run "Make Depend",
but I keep getting this error message: " *** No rule to make
target `depend'. Stop.".
------------------------------
Date: Wed, 06 Jul 2005 06:22:30 GMT
From: pjmooney@panix.com (Paul J Mooney)
Subject: What is a dependency? - Installation problem
Message-Id: <1107_1120630950@pm1-13.dynamic.access.net>
What, in Perl, is a dependency? The
reason that I'm asking is that I've
been trying to install Perl (Version
5.8.6) on a DOS/DJGPP platform,
but I can't get the dependencies to
compile with Make. After running
Configure, I've tried to run "Make
Depend", but I keep getting this error
message: " *** No rule to make target
`depend'. Stop.".
------------------------------
Date: Wed, 06 Jul 2005 06:22:42 GMT
From: pjmooney@panix.com (Paul J Mooney)
Subject: What is a dependency? - Installation problem
Message-Id: <1108_1120630962@pm1-13.dynamic.access.net>
What, in Perl, is a dependency? The
reason that I'm asking is that I've
been trying to install Perl (Version
5.8.6) on a DOS/DJGPP platform,
but I can't get the dependencies to
compile with Make. After running
Configure, I've tried to run "Make
Depend", but I keep getting this error
message: " *** No rule to make target
`depend'. Stop.".
------------------------------
Date: Wed, 06 Jul 2005 08:38:51 +0200
From: Gunnar Hjalmarsson <noreply@gunnar.cc>
Subject: Re: What is a dependency? - Installation problem
Message-Id: <3j1cjuFnpm0rU1@individual.net>
[ Please fix the problem with your computer. I see four instances of
your message! ]
Paul J Mooney wrote:
> What, in Perl, is a dependency?
A *module* dependency is info about which other modules a module needs
in order to work.
> The reason that I'm asking is that I've been trying to install Perl
> (Version 5.8.6) on a DOS/DJGPP platform,
Are you aware of ActiveState and IndigoPerl? I'm an advocate of the
latter (http://www.indigostar.com/indigoperl.htm) since it gives you
Apache with CGI, mod_perl and PHP thrown in. (Besides that, the actual
Perl bundles are very similar AFAIK.)
--
Gunnar Hjalmarsson
Email: http://www.gunnar.cc/cgi-bin/contact.pl
------------------------------
Date: Wed, 6 Jul 2005 18:20:15 +1000
From: "Sisyphus" <sisyphus1@nomail.afraid.org>
Subject: Re: What is a dependency? - Installation problem
Message-Id: <42cb9458$0$20855$afc38c87@news.optusnet.com.au>
"Paul J Mooney" <pjmooney@panix.com> wrote in message
news:1105_1120630653@pm1-13.dynamic.access.net...
> What, in Perl, is a dependency? The
> reason that I'm asking is that I've
> been trying to install Perl (Version
> 5.8.6) on a DOS/DJGPP platform,
> but I can't get the dependencies to
> compile with Make. After running
> Configure, I've tried to run "Make
> Depend", but I keep getting this error
> message: " *** No rule to make target
> `depend'. Stop.".
>
Why do you want run "Make Depend" ? README.dos (in the top level of the
source tarball) mentions nothing about running such a command. Does
something go awry when you try to build according to the README.dos
instructions ? If so, what is the error you are getting ? (Though I'm not
too sure that anyone here will be able to help :-)
Are you sure you want to use DJGPP to build perl ? You're quite entitled to
do that, of course, though mostly on Win32, people use one of the binaries
that Gunnar mentioned - or if they want to build perl themselves on Win32
they usually choose to build with either Microsoft's Visual Studio or the
freely available MinGW and dmake.
Cheers,
Rob
------------------------------
Date: 6 Apr 2001 21:33:47 GMT (Last modified)
From: Perl-Users-Request@ruby.oce.orst.edu (Perl-Users-Digest Admin)
Subject: Digest Administrivia (Last modified: 6 Apr 01)
Message-Id: <null>
Administrivia:
#The Perl-Users Digest is a retransmission of the USENET newsgroup
#comp.lang.perl.misc. For subscription or unsubscription requests, send
#the single line:
#
# subscribe perl-users
#or:
# unsubscribe perl-users
#
#to almanac@ruby.oce.orst.edu.
NOTE: due to the current flood of worm email banging on ruby, the smtp
server on ruby has been shut off until further notice.
To submit articles to comp.lang.perl.announce, send your article to
clpa@perl.com.
#To request back copies (available for a week or so), send your request
#to almanac@ruby.oce.orst.edu with the command "send perl-users x.y",
#where x is the volume number and y is the issue number.
#For other requests pertaining to the digest, send mail to
#perl-users-request@ruby.oce.orst.edu. Do not waste your time or mine
#sending perl questions to the -request address, I don't have time to
#answer them even if I did know the answer.
------------------------------
End of Perl-Users Digest V10 Issue 8230
***************************************
