[12401] in Perl-Users-Digest
Perl-Users Digest, Issue: 6002 Volume: 8
daemon@ATHENA.MIT.EDU (Perl-Users Digest)
Tue Jun 15 12:07:43 1999
Date: Tue, 15 Jun 99 09:01:32 -0700
From: Perl-Users Digest <Perl-Users-Request@ruby.OCE.ORST.EDU>
To: Perl-Users@ruby.OCE.ORST.EDU (Perl-Users Digest)
Perl-Users Digest Tue, 15 Jun 1999 Volume: 8 Number: 6002
Today's topics:
Re: HELP!!!!!!!!!!! <rootbeer@redcat.com>
Re: HELP!!!!!!!!!!! (Bart Lateur)
Re: how do I get the total space used in a directory (Larry Rosler)
Re: how do i make a Multi Dimensional array? (Larry Rosler)
How do I trim a string? <skerr@ryder.co.uk>
Re: Increment counter by Decials? (Larry Rosler)
Re: Load another html page ? <rootbeer@redcat.com>
Re: Mime...Perl...MS Outlook...and HTML <rootbeer@redcat.com>
Page Refresh <technology@workmail.com>
Re: parse a string in triplet ? (Marcel Grunauer)
Re: parse a string in triplet ? (Bart Lateur)
Re: Regex question <rootbeer@redcat.com>
Re: Regex question (Larry Rosler)
regexp trouble.. <office@asc.nl>
regexp trouble.. <office@asc.nl>
Re: regexp trouble.. <office@asc.nl>
Re: regexp trouble.. <gellyfish@gellyfish.com>
Re: regexp trouble.. <tchrist@mox.perl.com>
Re: regexp trouble.. (Bart Lateur)
Re: regexp trouble.. (Larry Rosler)
Re: Resizing hashes <rootbeer@redcat.com>
Unix Xrtns <nospam-dbown@sequent.com>
Re: Unix Xrtns <gellyfish@gellyfish.com>
Re: Verify User Input (Abigail)
Special: Digest Administrivia (Last modified: 12 Dec 98 (Perl-Users-Digest Admin)
----------------------------------------------------------------------
Date: Tue, 15 Jun 1999 07:29:16 -0700
From: Tom Phoenix <rootbeer@redcat.com>
Subject: Re: HELP!!!!!!!!!!!
Message-Id: <Pine.GSO.4.02A.9906150713090.4196-100000@user2.teleport.com>
On Tue, 15 Jun 1999 dansjohnson@geocities.com wrote:
> Subject: HELP!!!!!!!!!!!
Please check out this helpful information on choosing good subject
lines. It will be a big help to you in making it more likely that your
requests will be answered.
http://www.perl.com/CPAN/authors/Dean_Roehrich/subjects.post
> Have stuff due tomorow.
I'd rather not. :-)
But if you have stuff due tomorrow, you probably should have started
working on it earlier, don't you think? Don't let anyone say that college
doesn't teach skills you'll need in the real world; you're learning time
management.
Of course, the (perceived) urgency of your situation has nothing to do
with Perl or this newsgroup; you won't get your answers any faster (or
slower) by bragging about when stuff is due. Well, except for the delay
while I compose paragraphs like this one. :-)
> Have this error, what does it mean?
Have you looked for it in the perldiag manpage?
> I am trying to get the msql stuff installed properly, not sure if I
> messed up.
>
> Can't load '/usr/lib/perl5/site_perl/i386-linux/auto/DBD/mSQL/mSQL.so'
> for module DBD::mSQL:
Whether it was you or not, somebody messed up the installation. Make sure
that 'make test' works before doing 'make install'. Good luck with it!
--
Tom Phoenix Perl Training and Hacking Esperanto
Randal Schwartz Case: http://www.rahul.net/jeffrey/ovs/
------------------------------
Date: Tue, 15 Jun 1999 15:10:56 GMT
From: bart.lateur@skynet.be (Bart Lateur)
Subject: Re: HELP!!!!!!!!!!!
Message-Id: <37686cd5.32168803@news.skynet.be>
dansjohnson@geocities.com wrote:
>Have stuff due tomorow.
Ack. Too late!
>Have this error, what does it mean? I am trying
>to get the msql stuff installed properly, not sure if I messed up.
Yup. You messed up. The module wasn't installed properly.
Bart.
------------------------------
Date: Tue, 15 Jun 1999 07:53:23 -0700
From: lr@hpl.hp.com (Larry Rosler)
Subject: Re: how do I get the total space used in a directory
Message-Id: <MPG.11d008b4f116ec67989be6@nntp.hpl.hp.com>
[Posted and a courtesy copy sent.]
In article <Pine.GSO.4.02A.9906150634210.4196-100000@user2.teleport.com>
on Tue, 15 Jun 1999 06:52:17 -0700, Tom Phoenix <rootbeer@redcat.com>
says...
...
> Well, du isn't perfect, either; its manpage says that files containing
> holes and multiply-linked files may mess up the count. (And you should be
> able to read that manpage with the command 'cat man du', don't you think?)
No, I don't think (much, that is).
cat: cannot open man: No such file or directory
cat: cannot open du: No such file or directory
But you were thinking of the capital of Nepal, no doubt. :-)
> But check the source for du: If you really want your program to give
> exactly the same results as du, do as du does. :-)
I guess you *were*!
--
(Just Another Larry) Rosler
Hewlett-Packard Company
http://www.hpl.hp.com/personal/Larry_Rosler/
lr@hpl.hp.com
------------------------------
Date: Tue, 15 Jun 1999 08:29:18 -0700
From: lr@hpl.hp.com (Larry Rosler)
Subject: Re: how do i make a Multi Dimensional array?
Message-Id: <MPG.11d01124fc575211989be9@nntp.hpl.hp.com>
In article <37665362.D196E371@profero.com> on Tue, 15 Jun 1999 14:21:38
+0100, Simon <simon@profero.com> says...
> Bastiaan S van den Berg wrote:
> > you wouldn't be any chance know why this does work
> >
> > $config = substr($ENV{'HTTP_COOKIE'},7) || print "Set-Cookie: config=1\n";
> >
> > and this doesn't ?
> >
> > $config = substr($ENV{'HTTP_COOKIE'},7) or { print "Set-Cookie: config=1\n";
> > $config=1;
> > };
>
> Something to do with the relative binding strengths of || and 'or' possibly
Not at all. It has to do with basic syntax. You cannot dump a BLOCK
arbitrarily in the middle of an expression.
config = substr($ENV{'HTTP_COOKIE'},7) or do {
print "Set-Cookie: config=1\n";
$config=1;
};
--
(Just Another Larry) Rosler
Hewlett-Packard Company
http://www.hpl.hp.com/personal/Larry_Rosler/
lr@hpl.hp.com
------------------------------
Date: Tue, 15 Jun 1999 16:37:16 +0100
From: "Simon Kerr" <skerr@ryder.co.uk>
Subject: How do I trim a string?
Message-Id: <37667380.0@nnrp1.news.uk.psi.net>
Hi, I'm trying to trim a string that contains both alphabetic and numeric
chars. For example, "Call Detail For 012542916".
I want to remove all of the alphabetic (i.e. [a-zA-Z]) characters, so that
I'm just left with the numberic string ("012542916").
I've tried various functions - string matching, substitution and
translation. I think I'll use the substr function, as below:
substr($wholestring, n);
where $wholestring = the complete string and n = the length of the
alphabetical part of the string.
So, I just need to know how to find the length of the alphabetical part of
the string.
Phew, that was long-winded!
Thanks,
Simon
------------------------------
Date: Tue, 15 Jun 1999 06:58:08 -0700
From: lr@hpl.hp.com (Larry Rosler)
Subject: Re: Increment counter by Decials?
Message-Id: <MPG.11cffbb91b7a9620989be4@nntp.hpl.hp.com>
In article <m1l3k7.nsc.ln@magna.metronet.com> on Mon, 14 Jun 1999
15:26:46 -0400, Tad McClellan <tadmc@metronet.com> says...
...
> $saw_sold{$salesperson} += .5;
>
> But be aware that you are now using floating point instead of
> integers with the inaccuracies that go with them.
Fortunately, adding 0.5 repeatedly introduces no floating-point
inaccuracies whatever.
--
(Just Another Larry) Rosler
Hewlett-Packard Company
http://www.hpl.hp.com/personal/Larry_Rosler/
lr@hpl.hp.com
------------------------------
Date: Tue, 15 Jun 1999 08:19:42 -0700
From: Tom Phoenix <rootbeer@redcat.com>
Subject: Re: Load another html page ?
Message-Id: <Pine.GSO.4.02A.9906150816540.4196-100000@user2.teleport.com>
On Tue, 15 Jun 1999, Ken Patrick wrote:
> In a Perl script how do you reference an html page.
> if <cond>
> load html page
Do you mean that you want to redirect a remote browser to view a different
URL? If so, check the docs, FAQs, and newsgroups about browsers and their
protocols.
Do you mean that you want to fetch an HTML file over the net? If soo, see
the answer in section 9 of the FAQ.
Cheers!
--
Tom Phoenix Perl Training and Hacking Esperanto
Randal Schwartz Case: http://www.rahul.net/jeffrey/ovs/
------------------------------
Date: Tue, 15 Jun 1999 08:21:42 -0700
From: Tom Phoenix <rootbeer@redcat.com>
Subject: Re: Mime...Perl...MS Outlook...and HTML
Message-Id: <Pine.GSO.4.02A.9906150821170.4196-100000@user2.teleport.com>
On Tue, 15 Jun 1999, Tim Clark wrote:
> Well, when I do this, outlook thinks its plain text and displays the
> HTML tags from $mesg_text, which is hte problem. GRRR!!! Why is
> outlook so freaky?!?
If you're following the proper protocol but some browser or server doesn't
cooperate, then it's the other program's fault. If you're not following
the protocol, then it's your fault. If you aren't sure about the protocol,
you should read the protocol specification. If you've read it and you're
still not sure, you should ask in a newsgroup about the protocol.
Hope this helps!
--
Tom Phoenix Perl Training and Hacking Esperanto
Randal Schwartz Case: http://www.rahul.net/jeffrey/ovs/
------------------------------
Date: Tue, 15 Jun 1999 08:39:52 -0700
From: Raj <technology@workmail.com>
Subject: Page Refresh
Message-Id: <376673C8.BA0DF839@workmail.com>
Hi ,
How do i refresh the previos CGI/Perl script Page when the browser back
button is clicked? TIA,
~Raj
------------------------------
Date: Tue, 15 Jun 1999 13:51:44 GMT
From: marcel.grunauer@lovely.net (Marcel Grunauer)
Subject: Re: parse a string in triplet ?
Message-Id: <37715a00.18650287@enews.newsguy.com>
On Tue, 15 Jun 1999 14:59:52 +0200, Xavier Cousin
<cousin@ensam.inra.fr> wrote:
>Hello, I would like to parse a long string in triplets :
>
>a DNA sequence e.g. ACTGTGCATGACG...
>
>in triplets : ACT+GTG+CAT+GAC+G...
>
>I try to find indication on how to do this until the begining string
>(which could be a non 3 multiple) ends. But no success... I know how to
>do this once with substr but if i try to use a while loop, it loops and
>never ends...
The boring way...
#!/usr/bin/perl -w
use strict;
my $dna = 'ACTGTGCATGACGACTGTGCATGACGACTGTGCATGACGAGTA';
while (length $dna > 3) {
print substr($dna,0,3), '+';
substr($dna,0,3)=''; # Empty string, not double quote
}
print $dna;
I'm sure someone can come up with a more elegant solution, more
idiomatic (Larry? Bart?)
HTH
Marcel
------------------------------
Date: Tue, 15 Jun 1999 15:34:28 GMT
From: bart.lateur@skynet.be (Bart Lateur)
Subject: Re: parse a string in triplet ?
Message-Id: <37677168.33340408@news.skynet.be>
Marcel Grunauer wrote:
>while (length $dna > 3) {
> print substr($dna,0,3), '+';
> substr($dna,0,3)=''; # Empty string, not double quote
>}
>print $dna;
>I'm sure someone can come up with a more elegant solution, more
>idiomatic (Larry? Bart?)
As of 5.005, substr() now also accepts 4 parameters, the fourth being a
replacement string.
while(length $dna > 3) {
print substr($dna,0,3,""), '+';
}
print $dna;
Bart.
------------------------------
Date: Tue, 15 Jun 1999 07:10:30 -0700
From: Tom Phoenix <rootbeer@redcat.com>
Subject: Re: Regex question
Message-Id: <Pine.GSO.4.02A.9906150702230.4196-100000@user2.teleport.com>
On Tue, 15 Jun 1999, Jody Fedor wrote:
> OK, there's more than one way to skin a cat....
>
> $date=localtime;
> $date =~ s/://g;
> $date =~ s/(\w+){6} /,/;
>
> print $date;
>
> Looks great and formatted.
>
> Tue Jun 15, 1999
Actually, I get "Tue Jun 15 ,1999" from that code. Doesn't look all that
great to me. But you're right, it is formatted. :-)
($date = localtime) =~ s/ [\d:]{8}/,/;
--
Tom Phoenix Perl Training and Hacking Esperanto
Randal Schwartz Case: http://www.rahul.net/jeffrey/ovs/
------------------------------
Date: Tue, 15 Jun 1999 07:36:14 -0700
From: lr@hpl.hp.com (Larry Rosler)
Subject: Re: Regex question
Message-Id: <MPG.11d004b93c3e9235989be5@nntp.hpl.hp.com>
[Posted and a courtesy copy sent.]
In article <7k4qe6$mrp$1@plonk.apk.net> on Tue, 15 Jun 1999 02:34:49 -
0400, Jody Fedor <JFedor@datacom-css.com> says...
>
> OK, there's more than one way to skin a cat....
>
> $date=localtime;
> $date =~ s/://g;
> $date =~ s/(\w+){6} /,/;
>
> print $date;
>
> Looks great and formatted.
>
> Tue Jun 15, 1999
>
> instead of
>
> Tue Jun 15 02:33:23 1999
Actually, what you posted produces this:
Tue Jun 15 ,1999
You are too fixated on '\w' (and the '+' in your regex is meaningless in
any case).
my $date = localtime;
$date =~ s/ \d\d:\d\d:\d\d/,/;
I wouldn't even bother with a regex.
substr($date, 10, 9) = ',';
--
(Just Another Larry) Rosler
Hewlett-Packard Company
http://www.hpl.hp.com/personal/Larry_Rosler/
lr@hpl.hp.com
------------------------------
Date: Tue, 15 Jun 1999 16:26:00 +0200
From: "Bastiaan S van den Berg" <office@asc.nl>
Subject: regexp trouble..
Message-Id: <7k5nu7$4ea$1@zonnetje.NL.net>
i get the error :[ cookiesite.cgi: /3020 103 3020\w+)/: unmatched () in
regexp ]
the regexp that causes the error is :
$HTML =~ s/$(\w+)/$\1/g;
it's supposed to look for $vars in html code and replace them with the
actual values
from my program
could someone tell me what is wrong?
i've read every bit on regexp i could find and understand :)
--
Bastiaan v/d Berg ; aka buZz
Internet Specialist
Account Software Consultancy
-[ http://www.asc.nl/ ]-[ office@asc.nl ]-
-[ http://huizen.ddsw.nl/bewoners/buzz/ ]-[ buzz@ddsw.nl ]-
------------------------------
Date: Tue, 15 Jun 1999 16:26:00 +0200
From: "Bastiaan S van den Berg" <office@asc.nl>
Subject: regexp trouble..
Message-Id: <7k5nt7$4db$1@zonnetje.NL.net>
i get the error :[ cookiesite.cgi: /3020 103 3020\w+)/: unmatched () in
regexp ]
the regexp that causes the error is :
$HTML =~ s/$(\w+)/$\1/g;
it's supposed to look for $vars in html code and replace them with the
actual values
from my program
could someone tell me what is wrong?
i've read every bit on regexp i could find and understand :)
--
Bastiaan v/d Berg ; aka buZz
Internet Specialist
Account Software Consultancy
-[ http://www.asc.nl/ ]-[ office@asc.nl ]-
-[ http://huizen.ddsw.nl/bewoners/buzz/ ]-[ buzz@ddsw.nl ]-
------------------------------
Date: Tue, 15 Jun 1999 16:32:06 +0200
From: "Bastiaan S van den Berg" <office@asc.nl>
Subject: Re: regexp trouble..
Message-Id: <7k5o8c$4u5$1@zonnetje.NL.net>
very sorry about the double post
--
Bastiaan v/d Berg ; aka buZz
Internet Specialist
Account Software Consultancy
-[ http://www.asc.nl/ ]-[ office@asc.nl ]-
-[ http://huizen.ddsw.nl/bewoners/buzz/ ]-[ buzz@ddsw.nl ]-
------------------------------
Date: 15 Jun 1999 15:36:05 +0100
From: Jonathan Stowe <gellyfish@gellyfish.com>
Subject: Re: regexp trouble..
Message-Id: <376664d5@newsread3.dircon.co.uk>
Bastiaan S van den Berg <office@asc.nl> wrote:
> i get the error :[ cookiesite.cgi: /3020 103 3020\w+)/: unmatched () in
> regexp ]
>
> the regexp that causes the error is :
> $HTML =~ s/$(\w+)/$\1/g;
>
You need to backwack them '$'s otherwise it will be looking for the variable
$(.
> it's supposed to look for $vars in html code and replace them with the
> actual values
> from my program
>
You probably want to read the section in perlfaq4:
=head2 How can I expand variables in text strings?
/J\
--
"I thought homogenous culture was a kind of yogurt used to alleviate
thrush" - Ben Elton
------------------------------
Date: 15 Jun 1999 08:56:36 -0700
From: Tom Christiansen <tchrist@mox.perl.com>
Subject: Re: regexp trouble..
Message-Id: <376669a4@cs.colorado.edu>
[courtesy cc of this posting mailed to cited author]
In comp.lang.perl.misc,
"Bastiaan S van den Berg" <buzz@ddsw.nl> writes:
:it's supposed to look for $vars in html code and replace them with the
:actual values [THIS IS A BAD WRAP FROM A BROKEN NEWS READER]
:from my program
:
:could someone tell me what is wrong?
Well, it's arguably wrong to blindly conflate the user-request
namespace with the program's.
Did you read the FAQ?
--tom
--
As of next week, passwords will be entered in Morse code.
------------------------------
Date: Tue, 15 Jun 1999 15:04:20 GMT
From: bart.lateur@skynet.be (Bart Lateur)
Subject: Re: regexp trouble..
Message-Id: <37666a77.31563310@news.skynet.be>
Bastiaan S van den Berg wrote:
>i get the error unmatched () in regexp
>the regexp that causes the error is :
>$HTML =~ s/$(\w+)/$\1/g;
You're looking for the special variable $( . Put a backslash in front of
it.
>it's supposed to look for $vars in html code and replace them with the
>actual values from my program
Although absolutely dispicable, this seems to work:
$name = "Bart";
$HTML = "Hello to you, \$name!\n";
$HTML =~ s/\$(\w+)/${$main::{$1}}/g;
print $HTML;
But you REALLY shopuldn't be doing this. Reason: your custom variables
are trampling all over your program variables. Use a hash containing
just those custom "variables". It should even be just as fast (since
variables are accessed through some kind of hash, too).
%value = ( name => "Bart");
$HTML = "Hello to you, \$name!\n";
$HTML =~ s/\$(\w+)/$value{$1}/g;
print $HTML;
Bart.
------------------------------
Date: Tue, 15 Jun 1999 08:41:56 -0700
From: lr@hpl.hp.com (Larry Rosler)
Subject: Re: regexp trouble..
Message-Id: <MPG.11d0141f493a8851989bea@nntp.hpl.hp.com>
[Posted and a courtesy copy sent.]
In article <7k5nt7$4db$1@zonnetje.NL.net> on Tue, 15 Jun 1999 16:26:00
+0200, Bastiaan S van den Berg <office@asc.nl> says...
> i get the error :[ cookiesite.cgi: /3020 103 3020\w+)/: unmatched () in
> regexp ]
>
> the regexp that causes the error is :
> $HTML =~ s/$(\w+)/$\1/g;
>
> it's supposed to look for $vars in html code and replace them with the
> actual values from my program
>
> could someone tell me what is wrong?
>
> i've read every bit on regexp i could find and understand :)
Read perlfaq4: "How can I expand variables in text strings?"
--
(Just Another Larry) Rosler
Hewlett-Packard Company
http://www.hpl.hp.com/personal/Larry_Rosler/
lr@hpl.hp.com
------------------------------
Date: Tue, 15 Jun 1999 08:14:38 -0700
From: Tom Phoenix <rootbeer@redcat.com>
Subject: Re: Resizing hashes
Message-Id: <Pine.GSO.4.02A.9906150811120.4196-100000@user2.teleport.com>
On Mon, 14 Jun 1999, Thomas Weholt wrote:
> Does anybody know how resizing ( like removing parts of the value of
> some keys etc) of a hash stored on disc affects the size?
Depends upon how it's implemented. So you should probably check out the
source code.
> Does the filesize of the file stay the same or does it shrink too?
What happened when you tried it? :-)
You should be aware that many database files (on Unix systems, at least)
may have "holes" which take up no real disk space.
Cheers!
--
Tom Phoenix Perl Training and Hacking Esperanto
Randal Schwartz Case: http://www.rahul.net/jeffrey/ovs/
------------------------------
Date: 15 Jun 1999 14:17:49 GMT
From: "David Bown" <nospam-dbown@sequent.com>
Subject: Unix Xrtns
Message-Id: <01beb739$d8995960$c976549e@w-skefford.uk.sequent.com>
Are Perl scripts Unix XReturn sensitive?
ie, if someone has been saving scripts in wordpad will it affect
functionality?
thanks
------------------------------
Date: 15 Jun 1999 15:29:21 +0100
From: Jonathan Stowe <gellyfish@gellyfish.com>
Subject: Re: Unix Xrtns
Message-Id: <37666341@newsread3.dircon.co.uk>
David Bown <nospam-dbown@sequent.com> wrote:
> Are Perl scripts Unix XReturn sensitive?
>
> ie, if someone has been saving scripts in wordpad will it affect
> functionality?
>
Yes - especially if it was saved as a .WRI file ;-{ If the script is
to be run on a UNix system then you will need to transfer the file
from the PC in ASCII mode (assuming FTP) - if you are sharing the files
between a PC and unix then you will need to strip the \015s from the
line with some program.
You might check out the article on this matter by Dave Cross :
<http://www.mag-sol.com/Articles/index.html>
/J\
--
"I can't believe Elton John recorded that song again. Exactly how do you
live your life like a spurgis in the wind?" - Ronnie, Veronica's Closet
------------------------------
Date: 14 Jun 1999 23:38:08 -0500
From: abigail@delanet.com (Abigail)
Subject: Re: Verify User Input
Message-Id: <slrn7mbmlq.cmq.abigail@alexandra.delanet.com>
Ian Mortimer (ianmorty@nortelnetworks.com) wrote on MMCXIII September
MCMXCIII in <URL:news:3764A3FC.D9EF0C6C@nortelnetworks.com>:
$$
$$ The input form has several fields (names,dates,titles etc) and I am
$$ wondering if there are any other ways of verifying these inputs are
$$ correct e.g. the date is correct etc.
Did you bother to check out the various Date:: and Time:: modules?
$$ At the moment I am using some simple 'if' statements (see below).
$$ These
$$ 'if' statements could get a bit long and I was just wondering if there
$$ is
$$ a better way of doing this ???
Look ma, yet another posting with very silly linebreaks!
Abigail
--
perl -MTime::JulianDay -lwe'@r=reverse(M=>(0)x99=>CM=>(0)x399=>D=>(0)x99=>CD=>(
0)x299=>C=>(0)x9=>XC=>(0)x39=>L=>(0)x9=>XL=>(0)x29=>X=>IX=>0=>0=>0=>V=>IV=>0=>0
=>I=>$r=-2449231+gm_julian_day+time);do{until($r<$#r){$_.=$r[$#r];$r-=$#r}for(;
!$r[--$#r];){}}while$r;$,="\x20";print+$_=>September=>MCMXCIII=>()'
-----------== Posted via Newsfeeds.Com, Uncensored Usenet News ==----------
http://www.newsfeeds.com The Largest Usenet Servers in the World!
------== Over 73,000 Newsgroups - Including Dedicated Binaries Servers ==-----
------------------------------
Date: 12 Dec 98 21:33:47 GMT (Last modified)
From: Perl-Request@ruby.oce.orst.edu (Perl-Users-Digest Admin)
Subject: Special: Digest Administrivia (Last modified: 12 Dec 98)
Message-Id: <null>
Administrivia:
Well, after 6 months, here's the answer to the quiz: what do we do about
comp.lang.perl.moderated. Answer: nothing.
]From: Russ Allbery <rra@stanford.edu>
]Date: 21 Sep 1998 19:53:43 -0700
]Subject: comp.lang.perl.moderated available via e-mail
]
]It is possible to subscribe to comp.lang.perl.moderated as a mailing list.
]To do so, send mail to majordomo@eyrie.org with "subscribe clpm" in the
]body. Majordomo will then send you instructions on how to confirm your
]subscription. This is provided as a general service for those people who
]cannot receive the newsgroup for whatever reason or who just prefer to
]receive messages via e-mail.
The Perl-Users Digest is a retransmission of the USENET newsgroup
comp.lang.perl.misc. For subscription or unsubscription requests, send
the single line:
subscribe perl-users
or:
unsubscribe perl-users
to almanac@ruby.oce.orst.edu.
To submit articles to comp.lang.perl.misc (and this Digest), send your
article to perl-users@ruby.oce.orst.edu.
To submit articles to comp.lang.perl.announce, send your article to
clpa@perl.com.
To request back copies (available for a week or so), send your request
to almanac@ruby.oce.orst.edu with the command "send perl-users x.y",
where x is the volume number and y is the issue number.
The Meta-FAQ, an article containing information about the FAQ, is
available by requesting "send perl-users meta-faq". The real FAQ, as it
appeared last in the newsgroup, can be retrieved with the request "send
perl-users FAQ". Due to their sizes, neither the Meta-FAQ nor the FAQ
are included in the digest.
The "mini-FAQ", which is an updated version of the Meta-FAQ, is
available by requesting "send perl-users mini-faq". It appears twice
weekly in the group, but is not distributed in the digest.
For other requests pertaining to the digest, send mail to
perl-users-request@ruby.oce.orst.edu. Do not waste your time or mine
sending perl questions to the -request address, I don't have time to
answer them even if I did know the answer.
------------------------------
End of Perl-Users Digest V8 Issue 6002
**************************************